Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 20% [===========                                       ] |                     
 27% [==============                                    ] /                     
 34% [==================                                ] -                     
 41% [=====================                             ] \                     
 48% [=========================                         ] |                     
 55% [============================                      ] /                     
 62% [================================                  ] -                     
 69% [===================================               ] \                     
 76% [=======================================           ] |                     
 83% [==========================================        ] /                     
 90% [==============================================    ] -                     
 97% [================================================= ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/6b8dcb38-0c0d-4131-98a1-cada1bc3996f/final_image/ACLY_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.36 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.36 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.36 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.96 MB
Based on canonical annotations, the following gene is in your area of interest: ACLY(-)
write fasta - Elapsed time since the previous call: 1.78 seconds
write fasta - Current memory usage: 171.96 MB
Length of region: 72 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.21 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/6b8dcb38-0c0d-4131-98a1-cada1bc3996f/fasta/ACLY.fasta" "/disk1/www/rails/humanrnamap/public/result/6b8dcb38-0c0d-4131-98a1-cada1bc3996f/ct/ACLY.ct" --SHAPE "ACLY.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 175.21 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/6b8dcb38-0c0d-4131-98a1-cada1bc3996f/ct/ACLY.ct" "/disk1/www/rails/humanrnamap/public/result/6b8dcb38-0c0d-4131-98a1-cada1bc3996f/fold_FE/ACLY.txt" -sh "ACLY.dat"

efn2 - Elapsed time since the previous call: 0.49 seconds
efn2 - Current memory usage: 175.21 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/6b8dcb38-0c0d-4131-98a1-cada1bc3996f/ct/ACLY.ct" 1 "/disk1/www/rails/humanrnamap/public/result/6b8dcb38-0c0d-4131-98a1-cada1bc3996f/fold_dbn/ACLY_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.21 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCAUGCCACAAGAUUCAGUCCCAAGUCCAAGAUCCCUGCAAGGAAAGAGCACCACCCUCUUCAGCCGCCACA', '-structureDBN', '................................(((......))).((((.......))))............', '-o', '/disk1/www/rails/humanrnamap/public/result/6b8dcb38-0c0d-4131-98a1-cada1bc3996f/final_image/ACLY_fold_1.svg', '-title', 'ACLY, -3.2 ± 0.4\n kcal/mol, AUC: 0.615', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '64,67,4,5,12,14,15,18,19,25,26,31,33,37,38,42,43,47,49,58,60,61', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '65,68,69,70', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '66,35,36,71,72,44,53,54,23,56,57,59,29', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,6,7,8,9,10,11,13,16,17,20,21,22,24,27,28,30,32,34,39,40,41,45,46,48,50,51,52,55,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 124.18045074588144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 124.18045074588144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 124.18045074588144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 124.18045074588144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 124.18045074588146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 124.18045074588146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 124.18045074588146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 124.18045074588146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 124.18045074588146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 124.18045074588146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.25, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.25, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.25, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.75, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 337.25, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 354.75, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 372.25, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 389.75, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 407.25, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 424.75, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 442.25, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 459.75, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 477.25, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 494.75, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 512.25, Y: 124.18045074588147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 529.75, Y: 124.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 547.25, Y: 124.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 564.75, Y: 124.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 564.75, Y: 104.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 564.75, Y: 84.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 555.9030999084971, Y: 69.0813941332967, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 558.8683050233931, Y: 51.834460769777635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 572.2500121168788, Y: 40.55709108162661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 589.7499878831212, Y: 40.55709108162661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 603.1316949766069, Y: 51.834460769777635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 606.0969000915028, Y: 69.08139413329673, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 597.25, Y: 84.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 597.25, Y: 104.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 597.25, Y: 124.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 614.75, Y: 124.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 632.25, Y: 124.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 632.25, Y: 104.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 632.25, Y: 84.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 632.25, Y: 64.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 621.7979233435556, Y: 50.144629216797526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 621.6508797232032, Y: 32.645241496017135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 631.8656171359235, Y: 18.435761138957673, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 648.5, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 665.1343828640765, Y: 18.435761138957673, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 675.3491202767968, Y: 32.645241496017135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 675.2020766564444, Y: 50.144629216797526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 664.75, Y: 64.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 664.75, Y: 84.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 664.75, Y: 104.18045074588149, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 664.75, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 682.25, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 699.75, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 717.25, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 734.75, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 752.25, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 769.75, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 787.25, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 804.75, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 822.25, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 839.75, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 857.25, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 874.75, Y: 124.1804507458815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 144.18045074588144, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 144.18045074588144, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 144.18045074588147, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 508.5, Y: 144.18045074588147, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 616.7341463777645, Y: 41.88999344515622, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 599.0900759093911, Y: 56.516443767060466, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 675.142135623731, Y: 138.32258636961245, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 836.0, Y: 144.1804507458815, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '72', X: 871.0, Y: 144.1804507458815, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ACLY, -3.2 ± 0.4
 kcal/mol, AUC: 0.615', X: 373.75, Y: 156.9804507458815, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 889.0, 156.9804507458815)
Updated viewBox: -0.25 0.0 894.25 161.9804507458815
Updated SVG: /disk1/www/rails/humanrnamap/public/result/6b8dcb38-0c0d-4131-98a1-cada1bc3996f/final_image/ACLY_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/6b8dcb38-0c0d-4131-98a1-cada1bc3996f/final_image/ACLY_fold_final_1.svg
