Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 67% [==================================                ] |                     
 73% [=====================================             ] /                     
 79% [========================================          ] -                     
 85% [===========================================       ] \                     
 91% [==============================================    ] |                     
 97% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/6ce5fbc9-8b8a-47ed-8517-ac7736ec41fb/final_image/HCFC1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.05 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.05 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.05 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.72 MB
Based on canonical annotations, the following gene is in your area of interest: HCFC1(-)
write fasta - Elapsed time since the previous call: 0.25 seconds
write fasta - Current memory usage: 171.72 MB
Length of region: 82 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 174.85 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/6ce5fbc9-8b8a-47ed-8517-ac7736ec41fb/fasta/HCFC1.fasta" "/disk1/www/rails/humanrnamap/public/result/6ce5fbc9-8b8a-47ed-8517-ac7736ec41fb/ct/HCFC1.ct" --SHAPE "HCFC1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 174.85 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/6ce5fbc9-8b8a-47ed-8517-ac7736ec41fb/ct/HCFC1.ct" "/disk1/www/rails/humanrnamap/public/result/6ce5fbc9-8b8a-47ed-8517-ac7736ec41fb/fold_FE/HCFC1.txt" -sh "HCFC1.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 174.85 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/6ce5fbc9-8b8a-47ed-8517-ac7736ec41fb/ct/HCFC1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/6ce5fbc9-8b8a-47ed-8517-ac7736ec41fb/fold_dbn/HCFC1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 174.85 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CGUCACCCCCCAGGCUGGCACCGCGCUGCUGGCUCCUUUCCCAACACAGAGGGUGUGCUCCAACCCCCCCUGUGAGACCCAC', '-structureDBN', '............((((((((......))))))))..........(((((.(((.((......)).))).)))))........', '-o', '/disk1/www/rails/humanrnamap/public/result/6ce5fbc9-8b8a-47ed-8517-ac7736ec41fb/final_image/HCFC1_fold_1.svg', '-title', 'HCFC1, -28.1 ± 1.1\n kcal/mol, AUC: 0.79', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,13,14,16,17,18,23,25,27,28,30,31,32,34,37,38,39,49,51,52,53,54,55,56,57,59,71,72,73,74,76', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '33,65,66,4,5,6,7,8,67,69,70,46,15,50', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,1,68,12,45,47,48,79,19,21,29,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '9,10,11,75,77,78,80,81,82,20,22,24,26,35,36,40,41,42,43,44,58,60,61,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 275.11204330765776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 275.11204330765776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 275.11204330765776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 275.11204330765776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 275.11204330765776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 275.11204330765776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 275.11204330765776, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 255.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 235.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 215.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 195.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 175.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 155.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 135.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 205.90309990849715, Y: 120.01298669507301, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 208.8683050233931, Y: 102.76605333155393, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 222.2500121168788, Y: 91.48868364340294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 239.7499878831212, Y: 91.48868364340294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 253.13169497660692, Y: 102.76605333155393, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 256.09690009150285, Y: 120.01298669507301, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 247.25, Y: 135.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 155.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 175.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 247.25, Y: 195.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 215.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 235.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 255.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 247.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 317.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 387.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 422.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 439.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 255.11204330765779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 439.75, Y: 235.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 215.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.75, Y: 195.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 433.07162284851074, Y: 178.93650687757503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.75, Y: 162.7609704474923, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.75, Y: 142.76097044749233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.75, Y: 122.76097044749233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 433.07162284851074, Y: 106.58543401740954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.75, Y: 90.40989758732681, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 439.75, Y: 70.40989758732675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 430.90309990849715, Y: 55.31084097474198, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 433.8683050233931, Y: 38.06390761122293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 447.2500121168788, Y: 26.786537923071933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 464.7499878831212, Y: 26.78653792307182, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 478.13169497660687, Y: 38.06390761122293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 481.09690009150285, Y: 55.31084097474198, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 70.40989758732675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 472.25, Y: 90.40989758732675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 478.92837715148926, Y: 106.58543401740954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 472.25, Y: 122.76097044749233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 472.25, Y: 142.76097044749233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 472.25, Y: 162.76097044749227, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 478.92837715148926, Y: 178.93650687757503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 472.25, Y: 195.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 472.25, Y: 215.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 472.25, Y: 235.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 472.25, Y: 255.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 472.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 489.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 524.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 542.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 559.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 577.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 594.75, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 612.25, Y: 275.1120433076578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 295.11204330765776, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 295.1120433076578, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 191.08083000536624, Y: 136.90833580190312, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 263.5, Y: 195.11204330765779, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 348.5, Y: 295.1120433076578, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 409.32162284851074, Y: 178.93650687757503, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 467.8604538195561, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 488.5, Y: 195.1120433076578, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 573.5, Y: 295.1120433076578, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '82', X: 608.5, Y: 295.1120433076578, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'HCFC1, -28.1 ± 1.1
 kcal/mol, AUC: 0.79', X: 247.0, Y: 307.9120433076578, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 0.0, 626.5, 307.9120433076578)
Updated viewBox: -0.25 -5.0 631.75 317.9120433076578
Updated SVG: /disk1/www/rails/humanrnamap/public/result/6ce5fbc9-8b8a-47ed-8517-ac7736ec41fb/final_image/HCFC1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/6ce5fbc9-8b8a-47ed-8517-ac7736ec41fb/final_image/HCFC1_fold_final_1.svg
