Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 37% [===================                               ] \                     
 43% [======================                            ] |                     
 49% [=========================                         ] /                     
 55% [============================                      ] -                     
 61% [===============================                   ] \                     
 67% [==================================                ] |                     
 74% [======================================            ] /                     
 80% [=========================================         ] -                     
 86% [============================================      ] \                     
 92% [===============================================   ] |                     
 98% [==================================================] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/6f243eba-dc3f-4e46-8538-5d69434056fe/final_image/CLASP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.85 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.85 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.85 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.44 MB
Based on canonical annotations, the following gene is in your area of interest: CLASP1(-)
write fasta - Elapsed time since the previous call: 0.78 seconds
write fasta - Current memory usage: 170.44 MB
Length of region: 81 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 173.62 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/6f243eba-dc3f-4e46-8538-5d69434056fe/fasta/CLASP1.fasta" "/disk1/www/rails/humanrnamap/public/result/6f243eba-dc3f-4e46-8538-5d69434056fe/ct/CLASP1.ct" --SHAPE "CLASP1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 173.62 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/6f243eba-dc3f-4e46-8538-5d69434056fe/ct/CLASP1.ct" "/disk1/www/rails/humanrnamap/public/result/6f243eba-dc3f-4e46-8538-5d69434056fe/fold_FE/CLASP1.txt" -sh "CLASP1.dat"

efn2 - Elapsed time since the previous call: 0.40 seconds
efn2 - Current memory usage: 173.62 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/6f243eba-dc3f-4e46-8538-5d69434056fe/ct/CLASP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/6f243eba-dc3f-4e46-8538-5d69434056fe/fold_dbn/CLASP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.62 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCCGGAGCAGUGCAUCAAGGUGCUCUGCCCCAUCAUCCAGACGGCCGACUACCCCAUCAACCUUGCUGCCAUCAAGAUGCA', '-structureDBN', '...((.((((.((((....)))).)))).))..((((..((.(((......................))).))..))))..', '-o', '/disk1/www/rails/humanrnamap/public/result/6f243eba-dc3f-4e46-8538-5d69434056fe/final_image/CLASP1_fold_1.svg', '-title', 'CLASP1, -22.8 ± 1.3\n kcal/mol, AUC: 0.717', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '64,65,67,4,5,68,7,72,10,11,12,76,78,15,79,19,20,21,22,24,26,27,33,36,40,43,44,47,50,57,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '66,69,6,70,9,13,14,16,23,25,28,29,30,31,45,46', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,35,34,80,81,51,55,56', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,3,71,8,73,74,75,77,17,18,32,37,38,39,41,42,48,49,52,53,54,58,59,60,61,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 327.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 50.57162284851074, Y: 311.27639148796163, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.249999999999986, Y: 295.10085505787885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 275.10085505787885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 255.10085505787885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 235.10085505787885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 50.57162284851074, Y: 218.92531862779612, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.249999999999986, Y: 202.74978219771333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 182.74978219771333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 162.74978219771333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 142.74978219771333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 53.70126561276089, Y: 125.61333753012212, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 64.749982120067, Y: 112.04215058358835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 82.25001787993297, Y: 112.04215058358835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 93.2987343872391, Y: 125.61333753012212, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 142.74978219771333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 162.74978219771333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 182.74978219771333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 202.74978219771333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 96.42837715148926, Y: 218.92531862779612, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 235.10085505787885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 255.10085505787885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 275.10085505787885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 295.1008550578788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 96.42837715148926, Y: 311.2763914879616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 327.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.25, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 327.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 142.25, Y: 307.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.25, Y: 287.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 131.87031668259823, Y: 273.36248869691326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 131.87031668259823, Y: 255.86248517304233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 241.77304595191129, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 221.77304595191129, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 135.57162284851074, Y: 205.5975095218285, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 189.42197309174577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 169.42197309174577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.25, Y: 149.42197309174577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 125.887168041043, Y: 143.21643324138012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 111.59496185945059, Y: 133.1177285217443, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 100.28080987395873, Y: 119.76703717632205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.66306045675607, Y: 104.01200977652837, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.22537317867092, Y: 86.85295092326862, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 90.18601071316505, Y: 69.3793087706187, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 95.4839810910611, Y: 52.70050472397082, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 104.78291015000502, Y: 37.875495013745706, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 117.49239831244512, Y: 25.8455363604362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 132.8055057260136, Y: 17.374424515344174, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 149.74998579213235, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 167.25001420786762, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 184.1944942739865, Y: 17.37442451534423, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 199.50760168755485, Y: 25.8455363604362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.21708984999498, Y: 37.875495013745706, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 221.5160189089389, Y: 52.70050472397077, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 226.81398928683495, Y: 69.37930877061865, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.7746268213291, Y: 86.85295092326862, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 224.33693954324394, Y: 104.01200977652837, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.7191901260413, Y: 119.76703717632205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 205.40503814054938, Y: 133.11772852174437, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 191.11283195895703, Y: 143.21643324138012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 174.75, Y: 149.42197309174577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.75, Y: 169.42197309174577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.75, Y: 189.42197309174577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 181.42837715148926, Y: 205.5975095218285, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 174.75, Y: 221.77304595191129, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.75, Y: 241.77304595191129, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 185.12968331740177, Y: 255.86248517304233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 185.12968331740177, Y: 273.36248869691326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 174.75, Y: 287.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 174.75, Y: 307.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 174.75, Y: 327.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 174.75, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 192.25, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 347.45192791804436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 367.45192791804436, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 33.5, Y: 235.10085505787885, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 105.85671253071123, Y: 140.36001913985683, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 100.14213562373095, Y: 341.5940635417753, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 118.75143489713474, Y: 238.6116892213456, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 65.526333759003, Y: 88.27977475000233, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 223.93601970350747, Y: 25.198263092418756, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 191.0, Y: 189.42197309174577, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 188.5, Y: 367.45192791804436, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '81', X: 206.0, Y: 367.45192791804436, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLASP1, -22.8 ± 1.3
 kcal/mol, AUC: 0.717', X: 50.26231341066455, Y: 380.2519279180444, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 241.93601970350747, 380.2519279180444)
Updated viewBox: -0.25 0.0 247.18601970350747 385.2519279180444
Updated SVG: /disk1/www/rails/humanrnamap/public/result/6f243eba-dc3f-4e46-8538-5d69434056fe/final_image/CLASP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/6f243eba-dc3f-4e46-8538-5d69434056fe/final_image/CLASP1_fold_final_1.svg
