Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  4% [===                                               ] -                     
  9% [=====                                             ] \                     
 13% [=======                                           ] |                     
 18% [==========                                        ] /                     
 23% [============                                      ] -                     
 27% [==============                                    ] \                     
 32% [=================                                 ] |                     
 37% [===================                               ] /                     
 41% [=====================                             ] -                     
 46% [========================                          ] \                     
 50% [==========================                        ] |                     
 55% [============================                      ] /                     
 60% [===============================                   ] -                     
 64% [=================================                 ] \                     
 69% [===================================               ] |                     
 74% [======================================            ] /                     
 78% [========================================          ] -                     
 83% [==========================================        ] \                     
 87% [============================================      ] |                     
 92% [===============================================   ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/6fe8a240-b12d-4f36-9b1e-b29cb56b6f2c/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.34 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.34 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.34 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 173.00 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.98 seconds
write fasta - Current memory usage: 173.00 MB
Length of region: 108 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.22 seconds
write dat - Current memory usage: 176.20 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/6fe8a240-b12d-4f36-9b1e-b29cb56b6f2c/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/6fe8a240-b12d-4f36-9b1e-b29cb56b6f2c/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.13 seconds
fold - Current memory usage: 176.20 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/6fe8a240-b12d-4f36-9b1e-b29cb56b6f2c/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/6fe8a240-b12d-4f36-9b1e-b29cb56b6f2c/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 176.20 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/6fe8a240-b12d-4f36-9b1e-b29cb56b6f2c/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/6fe8a240-b12d-4f36-9b1e-b29cb56b6f2c/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.20 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CGUAAGCUGUAGUAAAAUGAGCUCGAUUGUUGACAGAGAUGACAGUAGUAUUUUUGAUGGGUUGGUGGAAGAAGAUGACAAGGACAAAGCGAAAAGAGUAUCUAGAAA', '-structureDBN', '.....(((((.........(((......)))..........))))).((((((((.....(((.((.................))..)))...)))))))).......', '-o', '/disk1/www/rails/humanrnamap/public/result/6fe8a240-b12d-4f36-9b1e-b29cb56b6f2c/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -10.3 ± 1.1\n kcal/mol, AUC: 0.602', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,6,8,9,10,12,13,18,19,21,23,25,27,28,29,30,31,32,36,38,40,41,45,46,48,49,51,52,53,54,55,56,58,59,60,61,62,63,64,65,66,67,68,71,74,76,77,82,83,89,91,96,98,99,101,103,105', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '100,104,107,15,50,88,92,95', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '97,4,5,102,73,106,11,108,14,78,81,20,84,93,94', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,69,70,7,72,75,79,16,17,80,85,22,86,24,87,26,90,33,34,35,37,39,42,43,44,47,57']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 401.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 381.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 361.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 341.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 75.12826128813217, Y: 334.98667307480594, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 60.365727553568405, Y: 324.05402991316885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 49.00603165478532, Y: 309.61753456800307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 41.852243858407604, Y: 292.697770712434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.410099029541016, Y: 274.49087593604054, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 41.85224385840762, Y: 256.28398115964706, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 49.006031654785346, Y: 239.3642173040781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 60.36572755356846, Y: 224.92772195891226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 75.12826128813222, Y: 213.99507879727517, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25000000000003, Y: 207.33916772167103, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25000000000003, Y: 187.33916772167106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25000000000003, Y: 167.33916772167106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 83.40309990849718, Y: 152.24011110908634, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 86.36830502339312, Y: 134.9931777455672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 99.75001211687879, Y: 123.71580805741621, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 117.24998788312121, Y: 123.71580805741621, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 130.63169497660692, Y: 134.9931777455672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 133.59690009150287, Y: 152.24011110908623, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75000000000003, Y: 167.33916772167106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75000000000003, Y: 187.33916772167106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75, Y: 207.33916772167103, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 140.39546969401272, Y: 213.20389992069013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 154.1755150451575, Y: 222.65303511037135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 165.28420241174632, Y: 235.133935346487, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 173.0718340144474, Y: 249.91664821433008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.0829458734437, Y: 266.1365985030054, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.0829458734437, Y: 282.8451533690758, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 173.07183401444735, Y: 299.06510365775114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 165.28420241174632, Y: 313.8478165255942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 154.17551504515754, Y: 326.32871676170976, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 140.39546969401272, Y: 335.7778519513911, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 341.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 361.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 381.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 401.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.75, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 401.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 381.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 361.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 341.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 321.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 301.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 281.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 145.9269181079641, Y: 270.9107388294062, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 138.2313753596257, Y: 255.19359154383372, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 138.23137664360007, Y: 237.6935887727516, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 145.92692169827112, Y: 221.97644261642247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.7500051650968, Y: 211.2445993238164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 176.8841054340322, Y: 207.68472503362696, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 185.679013993194, Y: 189.72227577312844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.4739225523558, Y: 171.75982651262996, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 192.89300697171853, Y: 155.58687379548326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 201.42484478078254, Y: 141.7567820653469, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 201.42484478078254, Y: 121.7567820653469, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 185.70287599548084, Y: 114.07104660707807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 173.14913118730982, Y: 101.87865868215499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 165.0076086715158, Y: 86.38780837801391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.0850828766022, Y: 69.1335429633823, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 164.67115799802548, Y: 51.82565321659786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 172.5095700170956, Y: 36.179243755006155, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 184.82358087716636, Y: 23.744776795841858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 200.39294841162285, Y: 15.754430958676721, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 217.67484478078254, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 234.9567411499422, Y: 15.754430958676721, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 250.52610868439865, Y: 23.744776795841858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.8401195444695, Y: 36.179243755006155, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 270.6785315635396, Y: 51.82565321659786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 273.26460668496287, Y: 69.1335429633823, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 270.34208089004926, Y: 86.38780837801391, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.2005583742553, Y: 101.87865868215499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 249.64681356608423, Y: 114.07104660707807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 233.92484478078254, Y: 121.7567820653469, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 233.92484478078254, Y: 141.7567820653469, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 242.86114424983816, Y: 157.75713033730347, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.72487388847247, Y: 175.6109775563831, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 223.66290260066583, Y: 186.0515529212679, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.86799404150403, Y: 204.01400218176636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 206.07308548234224, Y: 221.97645144226485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 213.7686252823612, Y: 237.69359708599816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 213.76862335639993, Y: 255.19359708599805, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 206.07308009688248, Y: 270.91074103586675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 281.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 301.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 192.25, Y: 321.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 341.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 192.25, Y: 361.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.25, Y: 381.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 401.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.25, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.75, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 421.64258415041013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 421.6425841504102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.25, Y: 421.6425841504102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.75, Y: 421.6425841504102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 297.25, Y: 421.6425841504102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 314.75, Y: 421.6425841504102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 441.64258415041013, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 71.27781050210135, Y: 351.8109758078194, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 71.27781050210137, Y: 197.17077606426182, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 141.00000000000003, Y: 187.33916772167106, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 163.647567589331, Y: 341.3346264815207, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 136.0, Y: 381.64258415041013, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 147.61701060838112, Y: 193.08625682616326, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 138.33603044443169, Y: 69.3282268489371, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 289.5136591171334, Y: 69.3282268489371, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 222.1936551153449, Y: 224.24811657163394, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '100', X: 204.0, Y: 401.64258415041013, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '108', X: 306.5, Y: 441.6425841504102, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -10.3 ± 1.1
 kcal/mol, AUC: 0.602', X: 93.75, Y: 454.4425841504102, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 333.5, 454.4425841504102)
Updated viewBox: -0.25 0.0 338.75 459.4425841504102
Updated SVG: /disk1/www/rails/humanrnamap/public/result/6fe8a240-b12d-4f36-9b1e-b29cb56b6f2c/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/6fe8a240-b12d-4f36-9b1e-b29cb56b6f2c/final_image/CLOCK_fold_final_1.svg
