Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 19% [==========                                        ] |                     
 25% [=============                                     ] /                     
 32% [=================                                 ] -                     
 38% [====================                              ] \                     
 45% [=======================                           ] |                     
 51% [==========================                        ] /                     
 58% [==============================                    ] -                     
 64% [=================================                 ] \                     
 71% [====================================              ] |                     
 77% [=======================================           ] /                     
 84% [===========================================       ] -                     
 90% [==============================================    ] \                     
 97% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/73d2b5a8-9d0e-45f4-877c-5eca8c2ff4b6/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.75 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.75 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.75 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.21 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.36 seconds
write fasta - Current memory usage: 171.21 MB
Length of region: 77 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 174.64 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/73d2b5a8-9d0e-45f4-877c-5eca8c2ff4b6/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/73d2b5a8-9d0e-45f4-877c-5eca8c2ff4b6/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 174.64 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/73d2b5a8-9d0e-45f4-877c-5eca8c2ff4b6/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/73d2b5a8-9d0e-45f4-877c-5eca8c2ff4b6/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.52 seconds
efn2 - Current memory usage: 174.64 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/73d2b5a8-9d0e-45f4-877c-5eca8c2ff4b6/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/73d2b5a8-9d0e-45f4-877c-5eca8c2ff4b6/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 174.64 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGUCAACAAAAUGUACUGAGUGGGCACAGUCAGCAAACAUCUCUACCCAGUCAGACACAGAGCACUCUUACAGCCCC', '-structureDBN', '............((.((((.((((...((...........))...)))).)))))).....................', '-o', '/disk1/www/rails/humanrnamap/public/result/73d2b5a8-9d0e-45f4-877c-5eca8c2ff4b6/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -13.6 ± 0.6\n kcal/mol, AUC: 0.754', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,66,68,69,73,12,13,14,17,18,20,21,22,23,24,29,30,33,40,42,44,50,51,54,60,62', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '16,49,48,75,47', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,1,67,4,38,39,9,41,11,76,46,15,19,53,55', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '65,5,6,7,8,70,10,71,72,74,77,25,26,27,28,31,32,34,35,36,37,43,45,52,56,57,58,59,61,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 316.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 210.93438113341733, Y: 299.75697711612037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 221.65572209255677, Y: 285.925667783118, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 230.16734010780456, Y: 267.8272601525415, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 238.67895812305233, Y: 249.72885252196502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.19057613830012, Y: 231.63044489138852, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 248.0311588034033, Y: 214.15071888831991, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 260.9584993290042, Y: 202.35532710617125, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 269.4700539146394, Y: 184.2568896450048, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 277.98160850027455, Y: 166.15845218383836, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 286.4931630859097, Y: 148.06001472267192, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 280.38077334860714, Y: 131.66217997203515, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 283.41272624657836, Y: 114.42682228980658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 294.75422870593775, Y: 101.09938387223292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 311.2826043464339, Y: 95.34933243798241, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 319.79416834152954, Y: 77.25089940201508, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 311.77667468472134, Y: 61.69554891052303, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 311.3593372860301, Y: 44.20055068400768, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 318.6259980808464, Y: 28.28060174114978, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.1168049045328, Y: 17.13397603216947, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.1214917765563, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 366.22386388061125, Y: 16.709178057813574, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 379.98810170598796, Y: 27.51634653695703, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.6490077360646, Y: 43.250375018196564, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 387.66752702292496, Y: 60.75034046062342, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 380.03993909278137, Y: 76.5005479455441, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 366.29860537892455, Y: 87.33682411471523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.20412202497636, Y: 91.08219089404554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 340.69255802988073, Y: 109.18062393001281, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 346.80493845113494, Y: 125.57845322494907, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 343.77298476242424, Y: 142.81380227361976, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.4314894571934, Y: 156.14123579404767, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 315.90312396030515, Y: 161.89129092432907, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 307.39156937467, Y: 179.9897283854955, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 298.8800147890348, Y: 198.08816584666195, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 290.3684602033997, Y: 216.1866033078284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 289.5279046013427, Y: 233.666404973747, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 276.60048853798696, Y: 245.4618241661662, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 268.08887052273917, Y: 263.56023179674264, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 259.5772525074914, Y: 281.65863942731914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 251.0656344922436, Y: 299.75704705789565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 316.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 336.8360087775553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.25, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.25, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.25, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 404.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 422.25, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 439.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 457.25, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 492.25, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 509.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 527.25, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 544.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 562.25, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 579.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 597.25, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 614.75, Y: 336.8360087775554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 356.8360087775553, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 356.8360087775553, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 226.18273625750402, Y: 205.63913258786536, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 288.6478208210882, Y: 66.64125643644388, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 371.0984554940226, Y: 105.41720195947715, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 303.87632714724197, Y: 242.17799127420156, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 313.5, Y: 356.8360087775554, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 488.5, Y: 356.8360087775554, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '77', X: 611.0, Y: 356.8360087775554, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -13.6 ± 0.6
 kcal/mol, AUC: 0.754', X: 243.75, Y: 369.6360087775554, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 629.0, 369.6360087775554)
Updated viewBox: -0.25 0.0 634.25 374.6360087775554
Updated SVG: /disk1/www/rails/humanrnamap/public/result/73d2b5a8-9d0e-45f4-877c-5eca8c2ff4b6/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/73d2b5a8-9d0e-45f4-877c-5eca8c2ff4b6/final_image/CLOCK_fold_final_1.svg
