Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 46% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 63% [================================                  ] |                     
 69% [===================================               ] /                     
 75% [======================================            ] -                     
 81% [=========================================         ] \                     
 87% [============================================      ] |                     
 93% [===============================================   ] /                     
 98% [==================================================] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/745cad64-e404-477d-9b70-a62ace5f99f3/final_image/CALD1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.34 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.34 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.34 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.86 MB
Based on canonical annotations, the following gene is in your area of interest: CALD1(+)
write fasta - Elapsed time since the previous call: 0.81 seconds
write fasta - Current memory usage: 171.86 MB
Length of region: 86 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 175.27 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/745cad64-e404-477d-9b70-a62ace5f99f3/fasta/CALD1.fasta" "/disk1/www/rails/humanrnamap/public/result/745cad64-e404-477d-9b70-a62ace5f99f3/ct/CALD1.ct" --SHAPE "CALD1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 175.27 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/745cad64-e404-477d-9b70-a62ace5f99f3/ct/CALD1.ct" "/disk1/www/rails/humanrnamap/public/result/745cad64-e404-477d-9b70-a62ace5f99f3/fold_FE/CALD1.txt" -sh "CALD1.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 175.27 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/745cad64-e404-477d-9b70-a62ace5f99f3/ct/CALD1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/745cad64-e404-477d-9b70-a62ace5f99f3/fold_dbn/CALD1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.27 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGGUGAAUGCCCAGAACAGUGUGCCUGACGAGGAGGCCAAGACAACCACCACAAACACUCAAGUGGAAGGGGAUGAUGAGGCCGCA', '-structureDBN', '.(((....)))............(((....))).((((.......((.((((..........))))...))........))))...', '-o', '/disk1/www/rails/humanrnamap/public/result/745cad64-e404-477d-9b70-a62ace5f99f3/final_image/CALD1_fold_1.svg', '-title', 'CALD1, -19.5 ± 0.8\n kcal/mol, AUC: 0.937', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,5,8,9,14,19,20,21,22,23,26,27,30,32,33,35,36,41,59,63,64,65,66,69,70,71,72,74,75,77,78,80,81,84', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '83,37,25,11,47', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '34,38,10,46,49,50,51,82,55,24,57', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,6,7,12,13,15,16,17,18,28,29,31,39,40,42,43,44,45,48,52,53,54,56,58,60,61,62,67,68,73,76,79,85,86']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 333.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 313.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 18.701265612760892, Y: 296.63485612331823, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.749982120067017, Y: 283.06366917678446, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 47.25001787993298, Y: 283.06366917678446, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 58.29873438723911, Y: 296.63485612331823, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.75, Y: 313.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.75, Y: 333.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 72.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 107.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 229.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 247.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 264.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.25, Y: 333.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.25, Y: 313.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 278.7012656127609, Y: 296.6348561233183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 289.74998212006705, Y: 283.06366917678446, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 307.250017879933, Y: 283.06366917678446, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 318.2987343872391, Y: 296.63485612331823, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 314.75, Y: 313.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 314.75, Y: 333.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 314.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 349.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 349.75, Y: 333.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.75, Y: 313.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.75, Y: 293.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.88197600818853, Y: 286.3919180519065, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 320.9363479900808, Y: 274.6165118920245, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 312.09102935675185, Y: 259.5165180745329, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 308.1508493083654, Y: 242.46587420986606, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 309.4743220023307, Y: 225.01600615759332, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 315.94102560718204, Y: 208.75466489986178, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 326.962559398679, Y: 195.16145821798233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 341.53608191980913, Y: 185.47322224131887, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 338.5196156630029, Y: 165.7020075259416, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 326.1277195624126, Y: 153.32752015442026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 323.49859867484236, Y: 136.0135157061619, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 309.3564630511114, Y: 121.87138008243096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 295.21432742738045, Y: 107.72924445870007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 281.0721918036495, Y: 93.58710883496911, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.62530278186875, Y: 94.94915735472938, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.56812255181194, Y: 87.9909912336895, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 236.6315516657575, Y: 74.32934675131406, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 233.3567123988628, Y: 57.138519531993836, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.50451665810198, Y: 40.412814045615335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 250.87886740285853, Y: 28.038463300858723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 267.60457288923703, Y: 22.890659041619585, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.7954001085572, Y: 26.16549830851426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 298.4570445909327, Y: 37.10206919456863, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 305.4152107119726, Y: 53.15924942462556, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 304.0531621922123, Y: 70.6061384464063, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 318.19529781594326, Y: 84.74827407013726, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.3374334396742, Y: 98.89040969386815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 346.47956906340517, Y: 113.0325453175991, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 363.77598951301314, Y: 115.65277726798234, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 376.1502953711075, Y: 128.01838806461336, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 378.78268463108196, Y: 145.31296243426465, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 370.64783957549093, Y: 160.8002498586315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 373.66430583229715, Y: 180.57146457400876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 390.46380801447526, Y: 185.47317105553037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 405.03736203067695, Y: 195.16138674970506, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 416.05892837736576, Y: 208.75458634603035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 422.52566091623476, Y: 225.01593223961288, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 423.84915528169046, Y: 242.46581369091814, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 419.90898746395806, Y: 259.5164757768345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 411.06367112216736, Y: 274.6164883203277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 398.1180366276508, Y: 286.3919096518292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 382.25, Y: 293.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 382.25, Y: 313.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 382.25, Y: 333.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 382.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 399.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 417.25, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 434.75, Y: 353.77130079090944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 373.77130079090944, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 71.0, Y: 333.77130079090944, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 208.5, Y: 373.77130079090944, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 333.97763763996943, Y: 291.8895723176807, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 301.65125614844123, Y: 287.2125795907877, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 291.46432742738045, Y: 136.0135157061619, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 289.41287710006225, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 382.9874004561143, Y: 148.92060210843644, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 396.1273264937653, Y: 303.2199705746515, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '86', X: 431.0, Y: 373.77130079090944, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CALD1, -19.5 ± 0.8
 kcal/mol, AUC: 0.937', X: 153.75, Y: 386.57130079090945, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 449.0, 386.57130079090945)
Updated viewBox: -0.25 -5.0 454.25 396.57130079090945
Updated SVG: /disk1/www/rails/humanrnamap/public/result/745cad64-e404-477d-9b70-a62ace5f99f3/final_image/CALD1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/745cad64-e404-477d-9b70-a62ace5f99f3/final_image/CALD1_fold_final_1.svg
