Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/75793e6e-1baf-4e91-8ff9-38f0f0df8084/final_image/KPNB1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.03 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.03 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.03 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.65 MB
Based on canonical annotations, the following gene is in your area of interest: KPNB1(+)
write fasta - Elapsed time since the previous call: 0.59 seconds
write fasta - Current memory usage: 172.65 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.14 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/75793e6e-1baf-4e91-8ff9-38f0f0df8084/fasta/KPNB1.fasta" "/disk1/www/rails/humanrnamap/public/result/75793e6e-1baf-4e91-8ff9-38f0f0df8084/ct/KPNB1.ct" --SHAPE "KPNB1.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.14 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/75793e6e-1baf-4e91-8ff9-38f0f0df8084/ct/KPNB1.ct" "/disk1/www/rails/humanrnamap/public/result/75793e6e-1baf-4e91-8ff9-38f0f0df8084/fold_FE/KPNB1.txt" -sh "KPNB1.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.14 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/75793e6e-1baf-4e91-8ff9-38f0f0df8084/ct/KPNB1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/75793e6e-1baf-4e91-8ff9-38f0f0df8084/fold_dbn/KPNB1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.14 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAGGAAGUUUUAAAAUUGCUUCCUGGUCCUUAGAGGACUAAAAACAAGACCCUCAUUCCCACUUUCAUUUCCACUCUAGCAAAAA', '-structureDBN', '.(((((((.........))))))).(((((...)))))...............................................', '-o', '/disk1/www/rails/humanrnamap/public/result/75793e6e-1baf-4e91-8ff9-38f0f0df8084/final_image/KPNB1_fold_1.svg', '-title', 'KPNB1, -20.0 ± 0.6\n kcal/mol, AUC: 0.811', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,7,8,9,10,11,16,17,18,20,21,24,25,26,27,30,31,33,35,36,39,48,53,56,57,63,64,65,68,69,70,75,77,79', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '5,6,72,73,13,81,82,19,22,23,28,29,40,51,58,59', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,12,76,83,84,32,34,37,38,41,42,44,47,49,60,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,66,67,71,74,14,15,78,80,85,43,45,46,50,52,54,55,62']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 19.573387503327055, Y: 195.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 37.073387503327055, Y: 195.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 37.073387503327055, Y: 175.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 37.073387503327055, Y: 155.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 37.073387503327055, Y: 135.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 37.073387503327055, Y: 115.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 37.073387503327055, Y: 95.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 37.073387503327055, Y: 75.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 24.495638003537508, Y: 63.79155987339229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 19.748779040843075, Y: 46.94766465641487, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 24.12226725257726, Y: 30.002987705996134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 36.42806999499798, Y: 17.56045199349535, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 53.323387503327055, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 70.21870501165613, Y: 17.56045199349535, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 82.52450775407691, Y: 30.002987705996134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 86.89799596581103, Y: 46.94766465641487, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 82.1511370031166, Y: 63.79155987339229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 69.57338750332706, Y: 75.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 69.57338750332706, Y: 95.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 69.57338750332706, Y: 115.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 69.57338750332706, Y: 135.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 69.57338750332706, Y: 155.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 69.57338750332706, Y: 175.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 69.57338750332706, Y: 195.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 87.07338750332706, Y: 195.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 104.57338750332706, Y: 195.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 104.57338750332706, Y: 175.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 104.57338750332706, Y: 155.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 104.57338750332706, Y: 135.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 104.57338750332706, Y: 115.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 105.5135886418842, Y: 98.48437927055733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 120.82338750332706, Y: 90.00730131205222, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 136.13318636476993, Y: 98.48437927055733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 137.07338750332707, Y: 115.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 137.07338750332707, Y: 135.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 137.07338750332707, Y: 155.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 137.07338750332707, Y: 175.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 137.07338750332707, Y: 195.95912715747878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 154.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 172.07338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 189.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 207.07338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 224.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 242.07338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 259.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.07338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 294.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 312.07338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 329.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 347.07338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 364.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 382.07338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 399.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 417.07338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 434.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 452.07338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 487.07338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 504.57338750332707, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 522.073387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 539.573387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 557.073387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 574.573387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 592.073387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 609.573387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 627.073387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 644.573387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 662.073387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 679.573387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 697.073387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 714.573387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 732.073387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 749.573387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 767.073387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 784.573387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 802.073387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 819.573387503327, Y: 195.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 837.073387503327, Y: 195.95912715747883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 854.573387503327, Y: 195.95912715747883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 872.073387503327, Y: 195.95912715747883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 889.573387503327, Y: 195.95912715747883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 907.073387503327, Y: 195.95912715747883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 924.573387503327, Y: 195.95912715747883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 942.073387503327, Y: 195.95912715747883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 959.573387503327, Y: 195.95912715747883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 20.323387503327055, Y: 215.95912715747878, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: -4.0, Y: 47.16865532485082, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 85.82338750332706, Y: 115.95912715747878, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 81.60071303873305, Y: 110.43746197130122, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 168.32338750332707, Y: 215.9591271574788, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 343.32338750332707, Y: 215.9591271574788, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 518.323387503327, Y: 215.9591271574788, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 693.323387503327, Y: 215.9591271574788, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 868.323387503327, Y: 215.95912715747883, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 955.823387503327, Y: 215.95912715747883, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KPNB1, -20.0 ± 0.6
 kcal/mol, AUC: 0.811', X: 423.57338750332707, Y: 228.75912715747884, Width: 142.5, Height: 23
Calculated bounding box: (-4.0, 5.0, 973.823387503327, 228.75912715747884)
Updated viewBox: -9.0 0.0 987.823387503327 233.75912715747884
Updated SVG: /disk1/www/rails/humanrnamap/public/result/75793e6e-1baf-4e91-8ff9-38f0f0df8084/final_image/KPNB1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/75793e6e-1baf-4e91-8ff9-38f0f0df8084/final_image/KPNB1_fold_final_1.svg
