Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  4% [===                                               ] -                     
  8% [=====                                             ] \                     
 13% [=======                                           ] |                     
 17% [=========                                         ] /                     
 22% [============                                      ] -                     
 26% [==============                                    ] \                     
 31% [================                                  ] |                     
 35% [==================                                ] /                     
 40% [=====================                             ] -                     
 44% [=======================                           ] \                     
 49% [=========================                         ] |                     
 53% [===========================                       ] /                     
 58% [==============================                    ] -                     
 62% [================================                  ] \                     
 66% [==================================                ] |                     
 71% [====================================              ] /                     
 75% [======================================            ] -                     
 80% [=========================================         ] \                     
 84% [===========================================       ] |                     
 89% [=============================================     ] /                     
 93% [===============================================   ] -                     
 98% [==================================================] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/7666de45-12cd-495f-8864-cfb559c28e28/final_image/TFRC_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.77 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.77 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.77 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.39 MB
Based on canonical annotations, the following gene is in your area of interest: TFRC(-)
write fasta - Elapsed time since the previous call: 0.57 seconds
write fasta - Current memory usage: 170.39 MB
Length of region: 112 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 173.80 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/7666de45-12cd-495f-8864-cfb559c28e28/fasta/TFRC.fasta" "/disk1/www/rails/humanrnamap/public/result/7666de45-12cd-495f-8864-cfb559c28e28/ct/TFRC.ct" --SHAPE "TFRC.dat"

fold - Elapsed time since the previous call: 0.13 seconds
fold - Current memory usage: 173.80 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/7666de45-12cd-495f-8864-cfb559c28e28/ct/TFRC.ct" "/disk1/www/rails/humanrnamap/public/result/7666de45-12cd-495f-8864-cfb559c28e28/fold_FE/TFRC.txt" -sh "TFRC.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 173.80 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/7666de45-12cd-495f-8864-cfb559c28e28/ct/TFRC.ct" 1 "/disk1/www/rails/humanrnamap/public/result/7666de45-12cd-495f-8864-cfb559c28e28/fold_dbn/TFRC_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.80 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AUUUUCUUUUCCUCUGUCCCUUCCCCCAUAAGCCUCCAUUUAGUUCUUUGUUAUUUUUGUUUCUUCCAAAGCACAUUGAAAGAGAACCAGUUUCAGGUGUUUAGUUGCAGAC', '-structureDBN', '............(((((..((..........((((.......(((((((.(((....(((((......)))))...))).))))))).......))))....))..))))).', '-o', '/disk1/www/rails/humanrnamap/public/result/7666de45-12cd-495f-8864-cfb559c28e28/final_image/TFRC_fold_1.svg', '-title', 'TFRC, -9.6 ± 1.3\n kcal/mol, AUC: 0.422', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,5,7,8,9,10,13,15,16,17,21,22,29,32,35,39,40,41,43,44,45,47,48,49,50,51,52,54,55,56,57,58,59,60,61,62,64,65,71,76,77,78,82,84,90,91,92,93,96,97,98,99,100,101,102,104,105,106,107,110', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '34,67,18,19,6,53,23', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '89,68,37,103,73,42,11,12,109,81,24,25', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,66,69,70,72,74,75,14,79,80,83,20,85,86,87,88,26,27,28,30,31,94,33,95,36,38,108,46,111,112,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.25, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 520.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 500.70866379559334, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 480.70866379559334, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 460.70866379559334, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 204.37031668259823, Y: 446.61922457446224, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 204.37031668259823, Y: 429.1192210505913, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 415.02978182946026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 395.02978182946026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 199.0501145026607, Y: 387.2990484752378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 186.55537548583345, Y: 375.0462063671787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 178.51922934412386, Y: 359.5004353019424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 175.74784564972413, Y: 342.22125490349555, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 178.51924388708576, Y: 324.94207683758043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 186.55540311283735, Y: 309.3963125359445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 199.05015244222267, Y: 297.14348094404386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.7500444461016, Y: 289.41276080357886, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.08009840647307, Y: 286.9796819815376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.30179912700578, Y: 290.0883259167698, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 264.6875011844495, Y: 298.4268398744978, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 281.0046244482056, Y: 286.86174201951223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 297.32174771196173, Y: 275.2966441645268, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 313.63887097571785, Y: 263.7315463095414, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 310.8675018242912, Y: 246.45235660315723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 313.6389189675105, Y: 229.17317459413368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 321.67509934656766, Y: 213.62741347420308, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.1698693200876, Y: 201.37459309718315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.8697784013259, Y: 193.64389204724296, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 367.1998429194001, Y: 191.2108388866901, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.42154525041394, Y: 194.31951267218813, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 399.80723844967554, Y: 202.65805742897203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 416.1243831275985, Y: 191.0929897871581, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 432.44152780552145, Y: 179.5279221453443, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 448.7586724834444, Y: 167.96285450353037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 465.07581716136735, Y: 156.39778686171655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 481.3929618392903, Y: 144.83271921990263, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 497.71010651721326, Y: 133.26765157808882, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.04520797115083, Y: 118.46551385396538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.1038840887603, Y: 114.56052096360975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 540.4209882344451, Y: 102.9953961351058, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 556.7380923801298, Y: 91.43027130660187, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 558.4183417513168, Y: 74.01106144500943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 568.1033624222731, Y: 59.43531155847779, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 583.5110905719933, Y: 51.13747910560835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 601.0110312155983, Y: 51.072767268387224, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 616.4797051402591, Y: 59.256423979424085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 635.1158892981886, Y: 51.99745435338639, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 653.7520734561181, Y: 44.738484727348805, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 672.3882576140476, Y: 37.47951510131122, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 691.0244417719771, Y: 30.220545475273525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 701.8829128016932, Y: 16.49674284204218, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 719.0299808109974, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 734.3952079940764, Y: 21.376093685689284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 740.7467976212538, Y: 37.68273224263919, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 735.0953109717893, Y: 54.245034331116926, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 720.1006763488854, Y: 63.26778803188279, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 702.8202674142883, Y: 60.504344731908986, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 684.1840832563588, Y: 67.76331435794657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 665.5478990984293, Y: 75.02228398398427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 646.9117149404998, Y: 82.28125361002196, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 628.2755307825702, Y: 89.54022323605955, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 622.4177223122765, Y: 106.03070776276024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 609.4846761507736, Y: 117.81995358191398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 592.5237614658079, Y: 122.13010126491906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 575.5314202264486, Y: 117.94556554333974, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 559.2143160807639, Y: 129.51069037184368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.8972119350791, Y: 141.0758152003475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 533.5620967984908, Y: 155.8780321081839, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 516.5033414351608, Y: 159.78301167971358, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 500.1861967572379, Y: 171.3480793215275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 483.8690520793149, Y: 182.91314696334132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 467.55190740139193, Y: 194.47821460515524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 451.234762723469, Y: 206.04328224696906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 434.917618045546, Y: 217.60834988878298, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 418.6004733676231, Y: 229.1734175305968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 421.37181052458635, Y: 246.45258679194842, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 418.6003773841727, Y: 263.7317406586229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 410.56419780757903, Y: 279.27747376493676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 398.06944302894976, Y: 291.53027356832536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 382.3695583930799, Y: 299.2609670961002, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 365.039520572926, Y: 301.6940287788438, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 347.8178394965058, Y: 298.5853794094116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.4321549900692, Y: 290.2468716131451, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 316.1150317263131, Y: 301.81196946813054, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 299.79790846255696, Y: 313.37706732311597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 283.48078519880085, Y: 324.94216517810145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 286.2521543502571, Y: 342.2213293079533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 283.4807532043174, Y: 359.5004883062461, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 275.4446024125659, Y: 375.04623629250375, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.9498703215172, Y: 387.29905923143986, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 395.02978182946026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 415.02978182946026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 257.62968331740177, Y: 429.1192210505913, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 257.62968331740177, Y: 446.61922457446224, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 460.70866379559334, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 480.70866379559334, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 500.70866379559334, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 520.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 540.7086637955933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 560.7086637955933, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 560.7086637955933, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 191.25143489713474, Y: 411.8684250988946, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 228.72106900994515, Y: 266.98350379701395, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 340.23769906368636, Y: 174.52842337222182, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 491.7301117359742, Y: 102.14838944213648, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 642.7431038300804, Y: 26.1023005694193, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 687.6930528823965, Y: 86.39949851587608, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 541.3771930336675, Y: 172.1951565200128, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 422.9020923542048, Y: 291.15937803389335, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '100', X: 294.227570186912, Y: 365.7551621210671, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '110', X: 259.0, Y: 520.7086637955933, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '112', X: 256.5, Y: 560.7086637955933, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TFRC, -9.6 ± 1.3
 kcal/mol, AUC: 0.422', X: 306.7483988106269, Y: 573.5086637955933, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 751.2467976212538, 573.5086637955933)
Updated viewBox: -0.25 0.0 756.4967976212538 578.5086637955933
Updated SVG: /disk1/www/rails/humanrnamap/public/result/7666de45-12cd-495f-8864-cfb559c28e28/final_image/TFRC_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/7666de45-12cd-495f-8864-cfb559c28e28/final_image/TFRC_fold_final_1.svg
