Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  8% [=====                                             ] -                     
 16% [=========                                         ] \                     
 24% [=============                                     ] |                     
 32% [=================                                 ] /                     
 40% [=====================                             ] -                     
 48% [=========================                         ] \                     
 56% [=============================                     ] |                     
 64% [=================================                 ] /                     
 72% [=====================================             ] -                     
 80% [=========================================         ] \                     
 88% [=============================================     ] |                     
 96% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/79353dd6-6bc0-43fb-bce4-65e7fad8e540/final_image/RUNX1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.86 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.86 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.86 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 171.44 MB
Based on canonical annotations, the following gene is in your area of interest: RUNX1(-)
write fasta - Elapsed time since the previous call: 0.13 seconds
write fasta - Current memory usage: 171.44 MB
Length of region: 62 nt.
88.6% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 174.93 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/79353dd6-6bc0-43fb-bce4-65e7fad8e540/fasta/RUNX1.fasta" "/disk1/www/rails/humanrnamap/public/result/79353dd6-6bc0-43fb-bce4-65e7fad8e540/ct/RUNX1.ct" --SHAPE "RUNX1.dat"

fold - Elapsed time since the previous call: 0.07 seconds
fold - Current memory usage: 174.93 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/79353dd6-6bc0-43fb-bce4-65e7fad8e540/ct/RUNX1.ct" "/disk1/www/rails/humanrnamap/public/result/79353dd6-6bc0-43fb-bce4-65e7fad8e540/fold_FE/RUNX1.txt" -sh "RUNX1.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 174.93 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/79353dd6-6bc0-43fb-bce4-65e7fad8e540/ct/RUNX1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/79353dd6-6bc0-43fb-bce4-65e7fad8e540/fold_dbn/RUNX1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 174.93 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CUUUCAAAUUGAAAUGACGGUAUAACACAUCUACUGAAAAAGCAACGGGAAAUGUGGUCCUA', '-structureDBN', '...(((........))).((.....(((((...(((.........)))...)))))..))..', '-o', '/disk1/www/rails/humanrnamap/public/result/79353dd6-6bc0-43fb-bce4-65e7fad8e540/final_image/RUNX1_fold_1.svg', '-title', 'RUNX1, -8.4 ± 0.8\n kcal/mol, AUC: 0.598', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,9,10,11,15,16,19,20,21,23,30,32,35,36,38,39,41,42,47,48,49,53,54,55,56,57,58,60,61', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '50,6,27,25,26,59,28', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '33,5,37,7,43,13,14,18,51,22,24,29', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,34,8,40,12,44,45,46,17,52,62,31']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 281.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 281.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 281.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 281.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 261.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 241.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 45.59493192571631, Y: 228.5028651310405, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 42.911789309451706, Y: 211.2097666592507, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 50.063245393295375, Y: 195.23769149867474, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 64.7499927277997, Y: 185.7219171325675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 82.2500072722003, Y: 185.7219171325675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 96.93675460670464, Y: 195.23769149867474, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 104.0882106905483, Y: 211.20976665925076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 101.4050680742837, Y: 228.5028651310405, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 241.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 261.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 281.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 281.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 281.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 261.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.33852095483499, Y: 249.86726900420825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 105.1503829759977, Y: 233.187219670268, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.69255849458554, Y: 215.57885685425072, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 118.34596169922452, Y: 201.33027455329193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 134.51621202153368, Y: 193.91137288649054, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 152.26543323396274, Y: 195.1288472312164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.4075688576937, Y: 180.98671160748546, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 180.54970448142464, Y: 166.84457598375454, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.6918401051556, Y: 152.70244036002353, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 208.83397572888654, Y: 138.56030473629258, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 208.6414110364504, Y: 121.06136004685075, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 217.3357646309599, Y: 105.87391911763027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.52320556018032, Y: 97.17956552312077, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 250.0221502496222, Y: 97.37213021555695, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.16428587335315, Y: 83.229994591826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 278.3064214970841, Y: 69.08785896809499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 278.0163788708383, Y: 51.59027766760687, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 286.5702752385013, Y: 36.323308976229214, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 301.6444943871144, Y: 27.434136171529303, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.14421233168923, Y: 27.337451361173862, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.3157324420048, Y: 36.05951841173692, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 343.03779949256784, Y: 51.23103852205247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 342.94111468221246, Y: 68.73075646662735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.05194187751266, Y: 83.80497561524047, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 318.78497318613495, Y: 92.35887198290348, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 301.2873918856469, Y: 92.06882935665774, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 287.14525626191596, Y: 106.2109649803887, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 273.003120638185, Y: 120.3531006041197, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 273.1956853306212, Y: 137.8520452935616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.50133173611175, Y: 153.03948622278202, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.31389080689132, Y: 161.73383981729157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 231.81494611744935, Y: 161.5412751248554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 217.6728104937184, Y: 175.68341074858634, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 203.53067486998745, Y: 189.82554637231726, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 189.3885392462565, Y: 203.9676819960482, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 175.24640362252555, Y: 218.10981761977916, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 176.61468107510996, Y: 234.97173537029414, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 170.14069465046603, Y: 250.60132119928875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 157.25, Y: 261.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 157.25, Y: 281.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 174.75, Y: 281.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 281.55697931922066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 301.55697931922066, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 55.32975476678894, Y: 166.54254275628736, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 111.70921097790938, Y: 279.26802782988204, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 187.726904530039, Y: 128.62390300336446, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 320.49940330306663, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 274.89346735984276, Y: 167.18162184651294, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 167.64213562373095, Y: 295.6991149429516, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '62', X: 188.5, Y: 301.55697931922066, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'RUNX1, -8.4 ± 0.8
 kcal/mol, AUC: 0.598', X: 107.89389974628392, Y: 314.35697931922067, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 353.53779949256784, 314.35697931922067)
Updated viewBox: -0.25 -5.0 358.78779949256784 324.35697931922067
Updated SVG: /disk1/www/rails/humanrnamap/public/result/79353dd6-6bc0-43fb-bce4-65e7fad8e540/final_image/RUNX1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/79353dd6-6bc0-43fb-bce4-65e7fad8e540/final_image/RUNX1_fold_final_1.svg
