Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 27% [==============                                    ] -                     
 32% [=================                                 ] \                     
 38% [====================                              ] |                     
 43% [======================                            ] /                     
 49% [=========================                         ] -                     
 54% [============================                      ] \                     
 60% [===============================                   ] |                     
 65% [=================================                 ] /                     
 71% [====================================              ] -                     
 76% [=======================================           ] \                     
 82% [==========================================        ] |                     
 87% [============================================      ] /                     
 93% [===============================================   ] -                     
 98% [==================================================] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/7ae27f9c-0562-49c9-a6eb-1dd9119933c6/final_image/BCOR_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.09 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.09 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.09 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.62 MB
Based on canonical annotations, the following gene is in your area of interest: BCOR(-)
write fasta - Elapsed time since the previous call: 0.38 seconds
write fasta - Current memory usage: 170.62 MB
Length of region: 91 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 173.96 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/7ae27f9c-0562-49c9-a6eb-1dd9119933c6/fasta/BCOR.fasta" "/disk1/www/rails/humanrnamap/public/result/7ae27f9c-0562-49c9-a6eb-1dd9119933c6/ct/BCOR.ct" --SHAPE "BCOR.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 173.96 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/7ae27f9c-0562-49c9-a6eb-1dd9119933c6/ct/BCOR.ct" "/disk1/www/rails/humanrnamap/public/result/7ae27f9c-0562-49c9-a6eb-1dd9119933c6/fold_FE/BCOR.txt" -sh "BCOR.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 173.96 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/7ae27f9c-0562-49c9-a6eb-1dd9119933c6/ct/BCOR.ct" 1 "/disk1/www/rails/humanrnamap/public/result/7ae27f9c-0562-49c9-a6eb-1dd9119933c6/fold_dbn/BCOR_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.96 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAAGAAAGGACACUAUUACAUAUGAAAAUAUCUCUUCUUUAUAUAAGAGAAAUUACUCCAGUCAGAAGGACUUAGAAACAUGUUUUUUUCC', '-structureDBN', '...(((((((((.(((.....)))......((((((........)))))).........((((.....))))........)))))))))..', '-o', '/disk1/www/rails/humanrnamap/public/result/7ae27f9c-0562-49c9-a6eb-1dd9119933c6/final_image/BCOR_fold_1.svg', '-title', 'BCOR, -10.3 ± 0.9\n kcal/mol, AUC: 0.767', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,8,9,14,16,17,21,23,24,29,31,33,35,36,38,39,40,42,44,47,49,53,54,57,61,62,65,68,69,72,73,75,81,82,83,84,85,86,87,88,89', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '32,1,34,3,37,70,10,12,45,46,15,48,18,50,60', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '6,7,41,74,76,77,80,51,52,22,90,91', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,2,66,67,5,71,11,13,78,79,19,20,25,26,27,28,30,43,55,56,58,59,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 133.91321632949135, Y: 459.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 151.41321632949135, Y: 459.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 168.91321632949135, Y: 459.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 186.41321632949135, Y: 459.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 186.41321632949135, Y: 439.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 186.41321632949135, Y: 419.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 186.41321632949135, Y: 399.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 186.41321632949135, Y: 379.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 186.41321632949135, Y: 359.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 186.41321632949135, Y: 339.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 186.41321632949135, Y: 319.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 186.41321632949135, Y: 299.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 164.826367115117, Y: 293.34455151803013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 145.19103328425092, Y: 282.4514704210252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 131.04889766051994, Y: 296.59360604475614, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 116.906762036789, Y: 310.7357416684871, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 110.16105477682719, Y: 326.88338054853904, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 93.98104767528578, Y: 333.55107715469444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 77.81717762219101, Y: 326.84435569452233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 71.11045616201893, Y: 310.6804856414276, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 77.77815276817431, Y: 294.50047853988616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 93.92579164822622, Y: 287.7547712799243, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 108.06792727195717, Y: 273.61263565619333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 122.21006289568813, Y: 259.47050003246244, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 113.33784922963879, Y: 244.3862930406417, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.26396961050732, Y: 227.97417976171187, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 104.17870306749832, Y: 210.74830950019197, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 104.17870306749832, Y: 193.24832447425194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 107.26396961050732, Y: 176.02245421273204, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 113.33784922963876, Y: 159.61034093380215, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.2100628956881, Y: 144.52613394198147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 108.06792727195715, Y: 130.38399831825052, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 93.9257916482262, Y: 116.24186269451957, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 79.78365602449524, Y: 102.09972707078862, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 65.64152040076429, Y: 87.95759144705767, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 51.49938477703337, Y: 73.81545582332672, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 34.02735444167082, Y: 72.82618082899785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 19.90201890569018, Y: 62.495381970719905, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 13.664899342269347, Y: 46.14457622281179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 17.3213293935553, Y: 29.030809006494792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.695708348764143, Y: 16.656430051285952, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 46.809475565081144, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 63.16028131298931, Y: 19.237119563420833, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.49108017126726, Y: 33.36245509940136, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.48035516559612, Y: 50.834485434763906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 88.62249078932707, Y: 64.97662105849486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 102.76462641305802, Y: 79.11875668222581, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 116.90676203678898, Y: 93.26089230595676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 131.0488976605199, Y: 107.40302792968771, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 145.1910332842509, Y: 121.54516355341866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.3775402299168, Y: 113.10449287085578, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 174.77064665648308, Y: 107.14176065891593, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 190.94126571819942, Y: 103.82317962905404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 207.43863720236124, Y: 103.24125609071848, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 223.80289258749224, Y: 105.41221131391285, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 239.57787399800327, Y: 110.27552935707354, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 254.3238497236319, Y: 117.69564396468411, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.6297718552503, Y: 127.4657175119105, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.1247343522555, Y: 139.31340665719722, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 288.4883121449328, Y: 152.90845398375643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 307.24501958561876, Y: 145.96684566979093, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 326.0017270263047, Y: 139.02523735582542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 344.7584344669907, Y: 132.08362904185992, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 357.63270179385063, Y: 120.23018867063388, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 375.1186897986121, Y: 120.93092495127371, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.0031627847956, Y: 133.7765510426068, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 386.344624298024, Y: 151.26417909500742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 373.5277142441903, Y: 163.1796154911117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 356.0385479771847, Y: 162.56327863297463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.28184053649875, Y: 169.50488694694013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 318.52513309581275, Y: 176.44649526090564, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.76842565512675, Y: 183.38810357487108, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 301.5283986131377, Y: 200.79937851920158, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 300.19117434630243, Y: 218.24821318688595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 295.79864472385714, Y: 235.18797952281693, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 288.4884166387691, Y: 251.08799730091994, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 278.4895011302651, Y: 265.45015899941774, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 266.11513904460753, Y: 277.8245342552858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 251.75298798810093, Y: 287.8234650496301, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 235.8529779903832, Y: 295.13371005732125, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.91321632949135, Y: 299.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 218.91321632949135, Y: 319.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.91321632949135, Y: 339.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.91321632949135, Y: 359.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.91321632949135, Y: 379.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.91321632949135, Y: 399.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.91321632949135, Y: 419.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.91321632949135, Y: 439.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.91321632949135, Y: 459.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 236.41321632949135, Y: 459.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 253.91321632949132, Y: 459.52625770899004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 134.66321632949135, Y: 479.52625770899004, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 162.66321632949135, Y: 339.52625770899004, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 47.360470719892476, Y: 310.7046168396907, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 91.51904128774653, Y: 151.03606664620133, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: -4.0, Y: 19.47840703928364, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 144.74832751299047, Y: 101.82051387631299, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 289.9729105015886, Y: 133.605630873017, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 340.4734488504643, Y: 188.26159438762608, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 238.81662998598551, Y: 313.97321315273075, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 232.66321632949135, Y: 479.52625770899004, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '91', X: 250.16321632949132, Y: 479.52625770899004, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'BCOR, -10.3 ± 0.9
 kcal/mol, AUC: 0.767', X: 134.33403106353245, Y: 492.32625770899006, Width: 142.5, Height: 23
Calculated bounding box: (-4.0, 5.0, 397.5031627847956, 492.32625770899006)
Updated viewBox: -9.0 0.0 411.5031627847956 497.32625770899006
Updated SVG: /disk1/www/rails/humanrnamap/public/result/7ae27f9c-0562-49c9-a6eb-1dd9119933c6/final_image/BCOR_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/7ae27f9c-0562-49c9-a6eb-1dd9119933c6/final_image/BCOR_fold_final_1.svg
