Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 19% [==========                                        ] |                     
 25% [=============                                     ] /                     
 32% [=================                                 ] -                     
 38% [====================                              ] \                     
 44% [=======================                           ] |                     
 51% [==========================                        ] /                     
 57% [=============================                     ] -                     
 64% [=================================                 ] \                     
 70% [====================================              ] |                     
 76% [=======================================           ] /                     
 83% [==========================================        ] -                     
 89% [=============================================     ] \                     
 96% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/7cd9b5e8-cfc9-465a-b163-40c76d62fff2/final_image/SON_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.56 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.56 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.56 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.26 MB
Based on canonical annotations, the following gene is in your area of interest: SON(+)
write fasta - Elapsed time since the previous call: 0.14 seconds
write fasta - Current memory usage: 172.26 MB
Length of region: 78 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.76 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/7cd9b5e8-cfc9-465a-b163-40c76d62fff2/fasta/SON.fasta" "/disk1/www/rails/humanrnamap/public/result/7cd9b5e8-cfc9-465a-b163-40c76d62fff2/ct/SON.ct" --SHAPE "SON.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 175.76 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/7cd9b5e8-cfc9-465a-b163-40c76d62fff2/ct/SON.ct" "/disk1/www/rails/humanrnamap/public/result/7cd9b5e8-cfc9-465a-b163-40c76d62fff2/fold_FE/SON.txt" -sh "SON.dat"

efn2 - Elapsed time since the previous call: 0.44 seconds
efn2 - Current memory usage: 175.76 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/7cd9b5e8-cfc9-465a-b163-40c76d62fff2/ct/SON.ct" 1 "/disk1/www/rails/humanrnamap/public/result/7cd9b5e8-cfc9-465a-b163-40c76d62fff2/fold_dbn/SON_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.76 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CUAGGGAAAGAAAAAGAAAAAGAUCAAGCUCCAGGGAUAACCGAAAGACAGUUAGAGCUCGAAGUCGAACCCCAAGUC', '-structureDBN', '...(((...((............((.(((((..((.....))............))))).))..))...)))......', '-o', '/disk1/www/rails/humanrnamap/public/result/7cd9b5e8-cfc9-465a-b163-40c76d62fff2/final_image/SON_fold_1.svg', '-title', 'SON, -9.0 ± 1.0\n kcal/mol, AUC: 0.673', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '64,65,2,67,4,5,6,10,76,77,16,22,24,28,30,34,35,36,38,43,47,51,52,53,55,57,59,61', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '17,71,73,11,29,78', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '32,3,70,7,72,13,19,21,54,25,58,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,8,9,12,14,15,18,20,23,26,27,33,37,39,40,41,42,44,45,46,48,49,50,56,60,62,63,66,68,69,74,75']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 275.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 255.89690279241017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 44.74021374664858, Y: 243.6594441387362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 40.14890766143799, Y: 226.77246528410302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 44.74021374664858, Y: 209.8854864294698, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.24999999999997, Y: 197.6480277757958, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 177.6480277757958, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 41.61794131811257, Y: 169.96529162435814, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.15430464389584, Y: 157.7979807357641, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 21.09771955043425, Y: 142.3552759843809, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 18.248845172431004, Y: 125.17186514179974, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 20.89080112792641, Y: 107.95542642365012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 28.761031241479827, Y: 92.41692033824097, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 41.07739623701684, Y: 80.10055534270396, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 56.61590232242597, Y: 72.23032522915054, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 73.83234104057563, Y: 69.58836927365519, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 91.01575188315677, Y: 72.43724365165838, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 106.45845663453996, Y: 80.49382874511997, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 118.62576752313402, Y: 92.9574654193367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 126.30850367457165, Y: 108.58952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 146.30850367457165, Y: 108.58952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.4840401046544, Y: 101.91114694973487, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.65957653473717, Y: 108.58952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 198.65957653473717, Y: 108.58952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 218.65957653473717, Y: 108.58952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 238.6595765347372, Y: 108.58952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 258.6595765347372, Y: 108.58952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 266.5994563413642, Y: 92.59658452456404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.2251406326488, Y: 79.97090023327945, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 295.2180802093088, Y: 72.0310204266525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 295.2180802093088, Y: 52.03102042665245, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 288.56991060449093, Y: 35.84298012699787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 295.29612986053036, Y: 19.68721390074444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 311.4680802093088, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 327.6400305580873, Y: 19.68721390074444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.3662498141267, Y: 35.84298012699787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 327.7180802093088, Y: 52.03102042665245, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 327.7180802093089, Y: 72.03102042665245, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 343.35013889119625, Y: 79.71375657809006, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 355.81377556541304, Y: 91.88106746668416, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 363.8703606588746, Y: 107.32377221806735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 366.7192350368779, Y: 124.50718306064846, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 364.07727908138247, Y: 141.72362177879813, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 356.207048967829, Y: 157.2621278642073, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 343.89068397229204, Y: 169.57849285974424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 328.3521778868829, Y: 177.44872297329772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 311.13573916873327, Y: 180.09067892879307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 293.9523283261521, Y: 177.24180455078988, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 278.50962357476897, Y: 169.18521945732834, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 266.34231268617486, Y: 156.72158278311156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 258.6595765347372, Y: 141.08952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.6595765347372, Y: 141.08952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 218.65957653473717, Y: 141.08952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 198.65957653473717, Y: 141.08952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.65957653473717, Y: 141.08952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.4840401046544, Y: 147.7679012527134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 146.30850367457165, Y: 141.08952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 126.30850367457165, Y: 141.08952410122413, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 118.36862386794468, Y: 157.08246367788422, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 105.74293957666005, Y: 169.70814796916886, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.74999999999999, Y: 177.6480277757958, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.74999999999999, Y: 197.6480277757958, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 102.25978625335141, Y: 209.88548642946978, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 106.85109233856201, Y: 226.77246528410296, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 102.25978625335142, Y: 243.65944413873615, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 255.89690279241017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 275.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.75, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 295.8969027924102, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 315.8969027924102, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 34.200600207809806, Y: 192.40082207550063, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 70.20264079883255, Y: 49.58873107772365, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 234.9095765347372, Y: 88.58952410122413, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 350.61619158265376, Y: 35.794717765601604, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 330.713830138679, Y: 196.49203431227224, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 158.7340401046544, Y: 167.7679012527134, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 105.29939979219017, Y: 261.14410849270536, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '78', X: 191.0, Y: 315.8969027924102, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'SON, -9.0 ± 1.0
 kcal/mol, AUC: 0.673', X: 119.73461751843894, Y: 328.6969027924102, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 377.2192350368779, 328.6969027924102)
Updated viewBox: -0.25 0.0 382.4692350368779 333.6969027924102
Updated SVG: /disk1/www/rails/humanrnamap/public/result/7cd9b5e8-cfc9-465a-b163-40c76d62fff2/final_image/SON_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/7cd9b5e8-cfc9-465a-b163-40c76d62fff2/final_image/SON_fold_final_1.svg
