Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  7% [====                                              ] -                     
 14% [========                                          ] \                     
 21% [===========                                       ] |                     
 28% [===============                                   ] /                     
 35% [==================                                ] -                     
 42% [======================                            ] \                     
 49% [=========================                         ] |                     
 56% [=============================                     ] /                     
 63% [================================                  ] -                     
 70% [====================================              ] \                     
 77% [=======================================           ] |                     
 84% [===========================================       ] /                     
 91% [==============================================    ] -                     
 98% [==================================================] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/7de50083-6173-45b6-b9da-26e9d0e9751e/final_image/ITCH_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.92 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.92 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.92 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.48 MB
Based on canonical annotations, the following gene is in your area of interest: ITCH(+)
write fasta - Elapsed time since the previous call: 0.60 seconds
write fasta - Current memory usage: 172.48 MB
Length of region: 71 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.15 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/7de50083-6173-45b6-b9da-26e9d0e9751e/fasta/ITCH.fasta" "/disk1/www/rails/humanrnamap/public/result/7de50083-6173-45b6-b9da-26e9d0e9751e/ct/ITCH.ct" --SHAPE "ITCH.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 176.15 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/7de50083-6173-45b6-b9da-26e9d0e9751e/ct/ITCH.ct" "/disk1/www/rails/humanrnamap/public/result/7de50083-6173-45b6-b9da-26e9d0e9751e/fold_FE/ITCH.txt" -sh "ITCH.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.15 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/7de50083-6173-45b6-b9da-26e9d0e9751e/ct/ITCH.ct" 1 "/disk1/www/rails/humanrnamap/public/result/7de50083-6173-45b6-b9da-26e9d0e9751e/fold_dbn/ITCH_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.15 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAAGAAGACAGAAAAAUGCAACAACACAAACAGUCCCAAGUGGAAGCAACCCCUUACAGUUAUCGUUACCC', '-structureDBN', '.................................(((.....)))...........................', '-o', '/disk1/www/rails/humanrnamap/public/result/7de50083-6173-45b6-b9da-26e9d0e9751e/final_image/ITCH_fold_1.svg', '-title', 'ITCH, -2.2 ± 0.4\n kcal/mol, AUC: 0.957', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '65,66,67,4,7,11,17,18,33,34,40,41,42,43,46,54,55,59,60,61,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '35,36,23,56,12,44', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '38,70,8,14,16,51,52,24,58,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,5,6,9,10,13,15,19,20,21,22,25,26,27,28,29,30,31,32,37,39,45,47,48,49,50,53,57,64,68,69,71']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 109.75, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.75, Y: 94.50299518959781, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.25, Y: 94.50299518959783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 94.50299518959783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 94.50299518959783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 354.75, Y: 94.50299518959783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 372.25, Y: 94.50299518959783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 389.75, Y: 94.50299518959783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 407.25, Y: 94.50299518959783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 424.75, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 442.25, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 459.75, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 477.25, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 494.75, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 512.25, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 529.75, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 547.25, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 564.75, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 582.25, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 582.25, Y: 74.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 582.25, Y: 54.502995189597826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 575.6018303951821, Y: 38.31495488994322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 582.3280496512215, Y: 22.159188663689818, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 598.5, Y: 15.47197476294538, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 614.6719503487785, Y: 22.159188663689818, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 621.3981696048179, Y: 38.31495488994322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 614.75, Y: 54.502995189597826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 614.75, Y: 74.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 614.75, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 632.25, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 649.75, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 667.25, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 684.75, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 702.25, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 719.75, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 737.25, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 754.75, Y: 94.50299518959784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 772.25, Y: 94.50299518959785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 789.75, Y: 94.50299518959785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 807.25, Y: 94.50299518959785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 824.75, Y: 94.50299518959785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 842.25, Y: 94.50299518959785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 859.75, Y: 94.50299518959785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 877.25, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 894.75, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 912.25, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 929.75, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 947.25, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 964.75, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 982.25, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 999.75, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 1017.25, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 1034.75, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1052.25, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1069.75, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 1087.25, Y: 94.50299518959787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 114.50299518959781, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 114.50299518959781, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 114.50299518959783, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 508.5, Y: 114.50299518959784, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 625.0470123446084, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 716.0, Y: 114.50299518959784, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 891.0, Y: 114.50299518959787, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 1066.0, Y: 114.50299518959787, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '71', X: 1083.5, Y: 114.50299518959787, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ITCH, -2.2 ± 0.4
 kcal/mol, AUC: 0.957', X: 480.0, Y: 127.30299518959787, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 1101.5, 127.30299518959787)
Updated viewBox: -0.25 -5.0 1106.75 137.30299518959788
Updated SVG: /disk1/www/rails/humanrnamap/public/result/7de50083-6173-45b6-b9da-26e9d0e9751e/final_image/ITCH_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/7de50083-6173-45b6-b9da-26e9d0e9751e/final_image/ITCH_fold_final_1.svg
