Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 46% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 63% [================================                  ] |                     
 69% [===================================               ] /                     
 75% [======================================            ] -                     
 81% [=========================================         ] \                     
 87% [============================================      ] |                     
 93% [===============================================   ] /                     
 98% [==================================================] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/7eaf8402-c447-4224-b414-36c9a90d3c4f/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.33 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.33 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.33 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.92 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.34 seconds
write fasta - Current memory usage: 172.92 MB
Length of region: 86 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.32 seconds
write dat - Current memory usage: 176.13 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/7eaf8402-c447-4224-b414-36c9a90d3c4f/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/7eaf8402-c447-4224-b414-36c9a90d3c4f/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.14 seconds
fold - Current memory usage: 176.13 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/7eaf8402-c447-4224-b414-36c9a90d3c4f/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/7eaf8402-c447-4224-b414-36c9a90d3c4f/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.56 seconds
efn2 - Current memory usage: 176.13 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/7eaf8402-c447-4224-b414-36c9a90d3c4f/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/7eaf8402-c447-4224-b414-36c9a90d3c4f/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.13 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAACUUUCUUCUGGAAAUUCAUCUAAUAUCCAGCAACUUGCACCUAUAAAUAUGCAAGGCCAAGUUGUUCCUACUAACCAGAUUCA', '-structureDBN', '..........(((((.(((.....))).)))))(((((((..(((...........))).)))))))...................', '-o', '/disk1/www/rails/humanrnamap/public/result/7eaf8402-c447-4224-b414-36c9a90d3c4f/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -21.5 ± 0.7\n kcal/mol, AUC: 0.715', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,6,7,9,10,12,13,14,18,19,22,24,27,29,33,38,39,40,45,47,51,53,54,58,59,64,65,66,67,68,69,72,75,81,83,84', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,2,3,4,78,15,79,80,86,26,30,31,32,35,37,44,61,62,63', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '36,71,42,11,48,49,50,82,21,55,56,25,28,57', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '70,8,73,74,76,77,16,17,20,85,23,34,41,43,46,52,60']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 275.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 255.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 235.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 215.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 173.07162284851074, Y: 199.4106381134353, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 183.23510168335255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 163.23510168335255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 143.23510168335255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 173.10183039518208, Y: 127.04706138369792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.8280496512215, Y: 110.89129515744455, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 196.0, Y: 104.20408125670005, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.1719503487785, Y: 110.89129515744455, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.89816960481792, Y: 127.04706138369792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 143.23510168335255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 163.23510168335255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 183.23510168335255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 218.92837715148926, Y: 199.4106381134353, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 215.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.25, Y: 235.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.25, Y: 255.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 275.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 295.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 275.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 255.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 235.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 215.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 195.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 229.75, Y: 175.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 220.95286497225462, Y: 160.45809808575447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 224.0095663877714, Y: 143.22717070314658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 237.47348615648588, Y: 132.04812125921146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 244.35284558024284, Y: 113.2684936292832, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 251.2322050039998, Y: 94.48886599935494, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 241.8718088471146, Y: 79.70265224341685, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 239.9104912129808, Y: 62.31293210224851, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 245.7422754191274, Y: 45.81325251678197, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 258.1955720605399, Y: 33.518353728621605, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 274.76854809833395, Y: 27.898247083652336, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 292.13173823525557, Y: 30.081996547128142, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 306.79692533524724, Y: 39.63089285886804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 315.81791365073724, Y: 54.62658901683005, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.3824114439674, Y: 72.0564909128563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 311.1761154118791, Y: 88.4189792019952, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 298.44585335511596, Y: 100.42687499669043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 281.7490999026333, Y: 105.66782506295996, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 274.8697404788763, Y: 124.44745269288828, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.9903810551193, Y: 143.2270803228166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 271.04714415869086, Y: 160.45804661402158, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.25, Y: 175.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.25, Y: 195.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.25, Y: 215.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.25, Y: 235.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.25, Y: 255.58617454351807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.25, Y: 275.58617454351804, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 262.25, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.75, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.25, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 314.75, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 349.75, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.25, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 384.75, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 454.75, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 472.25, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 489.75, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 524.75, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 542.25, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 559.75, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 577.25, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 594.75, Y: 295.5861745435181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 315.58617454351804, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 315.58617454351804, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 149.35188862665504, Y: 126.99879902230168, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 228.5, Y: 235.58617454351807, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 206.07701415607406, Y: 177.33963827645547, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 269.00366274230976, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 286.9896878313423, Y: 163.95142945887514, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 311.0, Y: 315.5861745435181, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 486.0, Y: 315.5861745435181, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '86', X: 591.0, Y: 315.5861745435181, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -21.5 ± 0.7
 kcal/mol, AUC: 0.715', X: 233.75, Y: 328.3861745435181, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 609.0, 328.3861745435181)
Updated viewBox: -0.25 -5.0 614.25 338.3861745435181
Updated SVG: /disk1/www/rails/humanrnamap/public/result/7eaf8402-c447-4224-b414-36c9a90d3c4f/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/7eaf8402-c447-4224-b414-36c9a90d3c4f/final_image/CLOCK_fold_final_1.svg
