Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 57% [=============================                     ] \                     
 63% [================================                  ] |                     
 68% [===================================               ] /                     
 74% [======================================            ] -                     
 80% [=========================================         ] \                     
 86% [============================================      ] |                     
 91% [==============================================    ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/7f5bbdb4-d448-49bb-b596-8b95b61af7c7/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.68 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.68 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.68 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 173.32 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.64 seconds
write fasta - Current memory usage: 173.32 MB
Length of region: 87 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.68 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/7f5bbdb4-d448-49bb-b596-8b95b61af7c7/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/7f5bbdb4-d448-49bb-b596-8b95b61af7c7/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.68 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/7f5bbdb4-d448-49bb-b596-8b95b61af7c7/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/7f5bbdb4-d448-49bb-b596-8b95b61af7c7/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.68 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/7f5bbdb4-d448-49bb-b596-8b95b61af7c7/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/7f5bbdb4-d448-49bb-b596-8b95b61af7c7/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.68 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACGAGCACUCCACCCAGGCAGCAUUUACCAGCUCAUGAGAAGAUGGUGCAAAGAAGGUCAUCAUUUAGUAGUCAGUCCAUAAAUUCC', '-structureDBN', '..((((.((((.....)).)).........)))).(((..(((((((((.......).)))))))).....))).............', '-o', '/disk1/www/rails/humanrnamap/public/result/7f5bbdb4-d448-49bb-b596-8b95b61af7c7/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -10.1 ± 0.8\n kcal/mol, AUC: 0.632', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,5,9,17,18,21,24,25,26,31,33,36,37,39,42,44,45,46,47,48,53,56,57,58,61,64,65,66,68,69,71,72,75,76,80,84,85', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '32,81,34,54,11', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '70,73,10,74,12,77,14,78,79,23,87,30,35,40,41,43,55,59,62,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,67,4,6,7,8,13,15,16,82,19,20,83,22,86,27,28,29,38,49,50,51,52,60']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.88904524221024, Y: 256.0575334752616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 110.38904524221024, Y: 256.0575334752616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.88904524221024, Y: 256.0575334752616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.88904524221024, Y: 236.05753347526164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.88904524221024, Y: 216.05753347526164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.88904524221024, Y: 196.05753347526164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 112.85836908797543, Y: 186.19335695832714, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 102.99419257104094, Y: 171.16268080409236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 82.99419257104094, Y: 171.16268080409236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 65.9150909678851, Y: 174.9782840447703, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 47.816624000685636, Y: 183.4897758903395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 35.99698043830449, Y: 196.3950784399091, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 18.514742352057795, Y: 197.18384921361445, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 5.580955181767877, Y: 185.3953820837748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 167.91509829535877, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 16.50722205131774, Y: 154.95290181969636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 33.98544975163577, Y: 154.0797670686404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 52.08391671883521, Y: 145.56827522307123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 65.91523085138124, Y: 134.84704631184877, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 82.99419257104094, Y: 138.66268080409236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 102.99419257104094, Y: 138.66268080409236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 112.4467920400732, Y: 124.04906973370942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 126.80489303032729, Y: 114.21269839098187, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 143.84606958173302, Y: 110.67609451406992, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 160.93259451966665, Y: 113.98667313173479, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 175.41972139644503, Y: 123.63200464985752, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 185.06505291456781, Y: 138.1191315266359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 188.37563153223263, Y: 155.20565646456953, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 184.8390276553207, Y: 172.24683301597526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 175.00265631259316, Y: 186.60493400622937, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 160.38904524221024, Y: 196.05753347526164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 160.38904524221024, Y: 216.05753347526164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 160.38904524221024, Y: 236.05753347526164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 160.38904524221024, Y: 256.0575334752616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.88904524221024, Y: 256.0575334752616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 195.38904524221024, Y: 256.0575334752616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 195.38904524221024, Y: 236.05753347526164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 195.38904524221024, Y: 216.05753347526164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 182.4983505917442, Y: 205.10187535532975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 176.02436416710032, Y: 189.47228952633515, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.3926416196847, Y: 172.61037177582017, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 163.25050599595374, Y: 158.46823615208925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 149.1083703722228, Y: 144.3261005283583, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 134.96623474849184, Y: 130.18396490462735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 120.82409912476089, Y: 116.04182928089637, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 106.68196350102994, Y: 101.89969365716541, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.53982787729899, Y: 87.75755803343446, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 78.39769225356804, Y: 73.61542240970351, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 63.62290476760177, Y: 64.23671277533873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 46.87520681482147, Y: 69.31261719828893, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 30.361870270198267, Y: 63.51952574445386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 20.455825629659557, Y: 49.09314463177901, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 20.980075822571735, Y: 31.600993415770233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 31.732298923691133, Y: 17.793752894498766, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 48.56292950055814, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 64.97658495262078, Y: 19.069769940406275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.63880433690542, Y: 33.66057899948322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.00007401852872, Y: 35.85974134954921, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 101.37866264213082, Y: 50.6344520211407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 115.52079826586177, Y: 64.77658764487165, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 129.66293388959275, Y: 78.9187232686026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 143.8050695133237, Y: 93.06085889233356, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 157.94720513705465, Y: 107.2029945160645, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 172.0893407607856, Y: 121.34513013979546, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 186.23147638451655, Y: 135.48726576352644, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 200.3736120082475, Y: 149.6294013872574, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 218.12283322067657, Y: 148.41192704253154, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 234.29308354298573, Y: 155.83082870933296, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.9464867476247, Y: 170.07941101029172, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.48866226621254, Y: 187.687773826309, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 241.30052428737525, Y: 204.3678231602492, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.88904524221024, Y: 216.05753347526164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.88904524221024, Y: 236.05753347526164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.88904524221024, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 245.38904524221027, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 262.8890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 280.3890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 297.8890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 315.3890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.8890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 350.3890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.8890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 385.3890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.8890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 420.3890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.8890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 455.3890452422103, Y: 256.05753347526166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 93.63904524221024, Y: 276.0575334752616, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 57.804297798144006, Y: 194.4970822385818, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 66.24963588228259, Y: 123.45934247125751, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 185.20623491950408, Y: 200.93314548082583, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 152.5168124519004, Y: 192.57698761490997, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 42.694059451709066, Y: 89.3079694570335, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 125.9129338895927, Y: 50.634452021140675, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 263.6265467267826, Y: 189.802496428216, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 329.1390452422103, Y: 276.05753347526166, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '87', X: 451.6390452422103, Y: 276.05753347526166, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -10.1 ± 0.8
 kcal/mol, AUC: 0.632', X: 164.06952262110514, Y: 288.8575334752617, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 469.6390452422103, 288.8575334752617)
Updated viewBox: -0.25 0.0 474.8890452422103 293.8575334752617
Updated SVG: /disk1/www/rails/humanrnamap/public/result/7f5bbdb4-d448-49bb-b596-8b95b61af7c7/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/7f5bbdb4-d448-49bb-b596-8b95b61af7c7/final_image/CLOCK_fold_final_1.svg
