Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/80cc3a36-783d-4320-8196-79959063fc2b/final_image/TFRC_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.03 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.03 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.03 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.72 MB
Based on canonical annotations, the following gene is in your area of interest: TFRC(-)
write fasta - Elapsed time since the previous call: 1.15 seconds
write fasta - Current memory usage: 172.72 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.12 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/80cc3a36-783d-4320-8196-79959063fc2b/fasta/TFRC.fasta" "/disk1/www/rails/humanrnamap/public/result/80cc3a36-783d-4320-8196-79959063fc2b/ct/TFRC.ct" --SHAPE "TFRC.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.12 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/80cc3a36-783d-4320-8196-79959063fc2b/ct/TFRC.ct" "/disk1/www/rails/humanrnamap/public/result/80cc3a36-783d-4320-8196-79959063fc2b/fold_FE/TFRC.txt" -sh "TFRC.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.12 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/80cc3a36-783d-4320-8196-79959063fc2b/ct/TFRC.ct" 1 "/disk1/www/rails/humanrnamap/public/result/80cc3a36-783d-4320-8196-79959063fc2b/fold_dbn/TFRC_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.12 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACCUGAAGAGAAAGUUGUCGGAGAAACUGGACAGCACAGACUUCACCGGCACCAUCAAGCUGCUGAAUGAAAAUUCAUAUGUCCC', '-structureDBN', '...(((((.....((((((..........)))))).....))))).((((........)))).(((((....)))))........', '-o', '/disk1/www/rails/humanrnamap/public/result/80cc3a36-783d-4320-8196-79959063fc2b/final_image/TFRC_fold_1.svg', '-title', 'TFRC, -13.8 ± 0.9\n kcal/mol, AUC: 0.632', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,5,8,10,14,15,16,17,18,20,21,23,28,29,30,34,39,42,43,48,49,55,59,61,62,64,65,68,69,74,75,78,80,81,82', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '71', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '67,72,44,47,50,83,84,53,22,24,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,6,7,9,11,12,13,19,25,26,27,32,33,35,36,37,38,40,41,45,46,51,52,54,56,57,58,60,63,66,70,73,76,77,79,85']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 322.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 302.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 282.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 262.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 42.5665000621637, Y: 253.4686900738278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 32.72388044908553, Y: 238.99893332699835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.26244354248047, Y: 221.84464885629663, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 32.72388044908553, Y: 204.69036438559485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 42.5665000621637, Y: 190.22060763876547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 180.69979618512733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 160.69979618512733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 140.69979618512733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 120.69979618512735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 100.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 80.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 43.95007271746209, Y: 69.32609639184466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 37.51609813886415, Y: 53.051788915627185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.44301615805517, Y: 35.65822402352319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 49.2831056061255, Y: 21.186812469618417, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 64.75001267560181, Y: 13.000000000000114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 82.24998732439815, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 97.71689439387447, Y: 21.186812469618303, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.55698384194483, Y: 35.65822402352319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.48390186113588, Y: 53.05178891562707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 103.04992728253791, Y: 69.32609639184466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 80.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 100.6997961851273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 120.69979618512735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 140.69979618512733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 160.69979618512733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.74999999999999, Y: 180.69979618512733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 104.4334999378363, Y: 190.22060763876547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 114.27611955091447, Y: 204.69036438559485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 117.73755645751953, Y: 221.84464885629663, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 114.27611955091447, Y: 238.99893332699835, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 104.43349993783632, Y: 253.4686900738278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 262.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 282.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 302.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 322.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 322.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 302.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 282.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 113.09493192571631, Y: 269.9353873392858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 110.4117893094517, Y: 252.64228886749603, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 117.56324539329538, Y: 236.67021370692, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 132.24999272779968, Y: 227.1544393408128, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 149.75000727220032, Y: 227.1544393408128, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 164.43675460670462, Y: 236.67021370692007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 171.5882106905483, Y: 252.64228886749603, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 168.9050680742837, Y: 269.9353873392858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 157.25, Y: 282.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 157.25, Y: 302.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 157.25, Y: 322.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 157.25, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.75, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.25, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 192.25, Y: 322.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 302.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 282.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.25, Y: 262.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 188.7012656127609, Y: 245.85305685987478, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 199.74998212006702, Y: 232.28186991334096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 217.25001787993298, Y: 232.28186991334096, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 228.2987343872391, Y: 245.85305685987478, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 224.75, Y: 262.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 224.75, Y: 282.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 224.75, Y: 302.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 224.75, Y: 322.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 224.75, Y: 342.9895015274659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 242.25, Y: 342.98950152746596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 259.75, Y: 342.98950152746596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 277.25, Y: 342.98950152746596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 294.75, Y: 342.98950152746596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 312.25, Y: 342.98950152746596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 329.75, Y: 342.98950152746596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 347.25, Y: 342.98950152746596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 364.75, Y: 342.98950152746596, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 362.9895015274659, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 10.538811780647208, Y: 246.7544631728544, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 23.92131767495146, Y: 80.94513827428636, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 105.04698271183946, Y: 86.79999696664987, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 114.66867561883993, Y: 267.7660626006757, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 101.48507546094052, Y: 287.36759703062876, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 173.5, Y: 302.9895015274659, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 187.41341049766822, Y: 214.21890261077917, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 273.5, Y: 362.98950152746596, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 361.0, Y: 362.98950152746596, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TFRC, -13.8 ± 0.9
 kcal/mol, AUC: 0.632', X: 118.75, Y: 375.789501527466, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 379.0, 375.789501527466)
Updated viewBox: -0.25 0.0 384.25 380.789501527466
Updated SVG: /disk1/www/rails/humanrnamap/public/result/80cc3a36-783d-4320-8196-79959063fc2b/final_image/TFRC_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/80cc3a36-783d-4320-8196-79959063fc2b/final_image/TFRC_fold_final_1.svg
