Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 20% [===========                                       ] /                     
 25% [=============                                     ] -                     
 30% [================                                  ] \                     
 35% [==================                                ] |                     
 40% [=====================                             ] /                     
 45% [=======================                           ] -                     
 51% [==========================                        ] \                     
 56% [=============================                     ] |                     
 61% [===============================                   ] /                     
 66% [==================================                ] -                     
 71% [====================================              ] \                     
 76% [=======================================           ] |                     
 81% [=========================================         ] /                     
 86% [============================================      ] -                     
 91% [==============================================    ] \                     
 96% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/82c540cb-2ea7-4ccf-b3d9-87449d5063fc/final_image/KRAS_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 155.13 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 155.13 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 155.13 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 168.66 MB
Based on canonical annotations, the following gene is in your area of interest: KRAS(-)
write fasta - Elapsed time since the previous call: 0.54 seconds
write fasta - Current memory usage: 168.66 MB
Length of region: 98 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 171.61 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/82c540cb-2ea7-4ccf-b3d9-87449d5063fc/fasta/KRAS.fasta" "/disk1/www/rails/humanrnamap/public/result/82c540cb-2ea7-4ccf-b3d9-87449d5063fc/ct/KRAS.ct" --SHAPE "KRAS.dat"

fold - Elapsed time since the previous call: 0.12 seconds
fold - Current memory usage: 171.61 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/82c540cb-2ea7-4ccf-b3d9-87449d5063fc/ct/KRAS.ct" "/disk1/www/rails/humanrnamap/public/result/82c540cb-2ea7-4ccf-b3d9-87449d5063fc/fold_FE/KRAS.txt" -sh "KRAS.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 171.61 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/82c540cb-2ea7-4ccf-b3d9-87449d5063fc/ct/KRAS.ct" 1 "/disk1/www/rails/humanrnamap/public/result/82c540cb-2ea7-4ccf-b3d9-87449d5063fc/fold_dbn/KRAS_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 171.61 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AUUUUUAUAAUAAUUGAAAAGAUUUUAACAAGUAUAAAAAAUUCUCAUAGGAAUUAAAUGUAGUCUCCCUGUGUCAGACUGCUCUUUCAUAGUAUAAC', '-structureDBN', '...((((((....((((((...))))))....)))))).((((((....))))))....(((((((.........)))))))................', '-o', '/disk1/www/rails/humanrnamap/public/result/82c540cb-2ea7-4ccf-b3d9-87449d5063fc/final_image/KRAS_fold_1.svg', '-title', 'KRAS, -15.4 ± 0.8\n kcal/mol, AUC: 0.701', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,5,6,8,11,14,15,16,21,23,24,25,26,32,33,35,42,43,45,48,50,51,54,55,59,60,61,63,64,66,70,71,72,73,74,77,80,81,83,85,86,87,90,92,93,95', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,65,36,37,68,40,76,78,79,82,19,22', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '67,7,39,9,10,13,17,18,49,53,56,62,27,30,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '69,75,12,20,84,88,89,91,28,29,94,96,97,34,98,38,41,44,46,47,52,57,58']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 289.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 269.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 249.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 229.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 209.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 43.42691882602546, Y: 198.61796384907748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 35.73137587321534, Y: 182.90081789778648, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 35.73137587321534, Y: 165.40081623513717, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 43.42691882602546, Y: 149.68367028384617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 138.9518258454265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 118.9518258454265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 98.9518258454265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 78.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 58.95182584542647, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 38.95182584542647, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 58.19020113855714, Y: 21.477077958504992, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 73.5, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 88.80979886144286, Y: 21.477077958505106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 38.95182584542647, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 58.95182584542647, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 78.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 98.9518258454265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 118.9518258454265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 138.9518258454265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 103.57308117397454, Y: 149.68367028384617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 111.26862412678466, Y: 165.40081623513717, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 111.26862412678466, Y: 182.90081789778648, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 103.57308117397457, Y: 198.61796384907748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 209.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 229.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 249.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 269.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 289.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 289.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75, Y: 269.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75, Y: 249.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 229.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75, Y: 209.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 121.20126561276089, Y: 192.21336361990595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 132.24998212006702, Y: 178.64217667337218, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 149.75001787993298, Y: 178.64217667337218, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 160.7987343872391, Y: 192.21336361990595, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 157.25, Y: 209.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 157.25, Y: 229.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 157.25, Y: 249.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 157.25, Y: 269.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 157.25, Y: 289.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 157.25, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 174.75, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.75, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 309.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 289.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 269.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 249.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 229.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 244.75, Y: 209.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 189.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.17225050021045, Y: 177.18224100341067, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.42539153751602, Y: 160.33834578643322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 231.79887974925018, Y: 143.39366883601454, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.10468249167093, Y: 130.9511331235137, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 261.0, Y: 126.39068113001841, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 277.8953175083291, Y: 130.9511331235137, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 290.20112025074985, Y: 143.39366883601454, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 294.574608462484, Y: 160.33834578643322, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 289.82774949978955, Y: 177.18224100341067, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.25, Y: 189.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 277.25, Y: 209.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.25, Y: 229.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 277.25, Y: 249.34980828749715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 277.25, Y: 269.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 277.25, Y: 289.3498082874971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 277.25, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 294.75, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 312.25, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 329.75, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 347.25, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 364.75, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 382.25, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 399.75, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 417.25, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 434.75, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 452.25, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.75, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 487.25, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 504.75, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 522.25, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 539.75, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 557.25, Y: 309.3498082874972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 329.3498082874971, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 24.162915385014557, Y: 211.23999606391126, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 37.48907978138168, Y: 10.862960720867648, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 127.00257927176872, Y: 160.88689422559278, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 106.85786437626905, Y: 323.4919439112281, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 173.3567125307112, Y: 206.9600452296404, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 226.85786437626905, Y: 323.4919439112281, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 230.29095465843315, Y: 113.66757498004927, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 293.5, Y: 269.3498082874971, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 413.5, Y: 329.3498082874972, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '98', X: 553.5, Y: 329.3498082874972, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KRAS, -15.4 ± 0.8
 kcal/mol, AUC: 0.701', X: 215.0, Y: 342.1498082874972, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 2.8629607208676475, 571.5, 342.1498082874972)
Updated viewBox: -0.25 -2.1370392791323525 576.75 349.28684756662955
Updated SVG: /disk1/www/rails/humanrnamap/public/result/82c540cb-2ea7-4ccf-b3d9-87449d5063fc/final_image/KRAS_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/82c540cb-2ea7-4ccf-b3d9-87449d5063fc/final_image/KRAS_fold_final_1.svg
