Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 53% [===========================                       ] -                     
 59% [==============================                    ] \                     
 65% [=================================                 ] |                     
 71% [====================================              ] /                     
 77% [=======================================           ] -                     
 83% [==========================================        ] \                     
 89% [=============================================     ] |                     
 95% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/8a2c4559-acf0-4ab6-b327-80ff23999d5a/final_image/MALAT1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.62 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.62 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.62 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.13 MB
Based on canonical annotations, the following gene is in your area of interest: MALAT1(+)
write fasta - Elapsed time since the previous call: 0.54 seconds
write fasta - Current memory usage: 172.13 MB
Length of region: 84 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 175.57 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/8a2c4559-acf0-4ab6-b327-80ff23999d5a/fasta/MALAT1.fasta" "/disk1/www/rails/humanrnamap/public/result/8a2c4559-acf0-4ab6-b327-80ff23999d5a/ct/MALAT1.ct" --SHAPE "MALAT1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 175.57 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/8a2c4559-acf0-4ab6-b327-80ff23999d5a/ct/MALAT1.ct" "/disk1/www/rails/humanrnamap/public/result/8a2c4559-acf0-4ab6-b327-80ff23999d5a/fold_FE/MALAT1.txt" -sh "MALAT1.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 175.57 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/8a2c4559-acf0-4ab6-b327-80ff23999d5a/ct/MALAT1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/8a2c4559-acf0-4ab6-b327-80ff23999d5a/fold_dbn/MALAT1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.57 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAGCUAAGGGCAAAAUGUACAAACUUAGAAGAAAAUUGGAAGAUAGAAACAAGAUAGAAAAUGAAAAUAUUGUCAAGAGUUUCA', '-structureDBN', '...(((((...............)))))..((((....((.((((......................)))).)).....)))).', '-o', '/disk1/www/rails/humanrnamap/public/result/8a2c4559-acf0-4ab6-b327-80ff23999d5a/final_image/MALAT1_fold_1.svg', '-title', 'MALAT1, -3.0 ± 0.7\n kcal/mol, AUC: 0.554', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,5,8,9,10,16,17,18,25,26,28,31,36,37,38,39,42,44,46,53,55,57,62,63,68,70,71,72,73,77,79,80,81,82', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '33,84,13', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '32,1,2,65,7,40,41,59,76,45,51,52,56,27', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '4,6,11,12,14,15,19,20,21,22,23,24,29,30,34,35,43,47,48,49,50,54,58,60,61,64,66,67,69,74,75,78,83']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 393.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 393.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 393.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 393.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 373.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 353.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 333.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 313.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 41.94525971278425, Y: 305.04944983399827, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 30.496495071591568, Y: 291.81402802129185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 24.30274017499687, Y: 275.4467434984824, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 24.1208691985224, Y: 257.94767137114934, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.973106697009058, Y: 241.45519070173532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 41.14431177360561, Y: 227.9846755109079, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 56.269367988753274, Y: 219.18221694194483, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.5, Y: 216.12347163337654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 90.73063201124673, Y: 219.18221694194483, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 105.85568822639439, Y: 227.9846755109079, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 117.02689330299094, Y: 241.45519070173532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 122.8791308014776, Y: 257.94767137114934, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 122.69725982500313, Y: 275.4467434984824, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 116.50350492840843, Y: 291.81402802129185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 105.05474028721575, Y: 305.04944983399827, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 313.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 333.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 353.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 373.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 393.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.25, Y: 393.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 393.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 393.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 373.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 353.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 333.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.9544110988042, Y: 323.4418537774459, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 119.0907904885926, Y: 308.3526279783814, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 117.23536923348783, Y: 290.9513085599285, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 122.71809970261091, Y: 274.33239848315543, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 134.56397964104954, Y: 261.45126367208326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 130.34691051814758, Y: 241.90091001766905, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 120.4080194712333, Y: 227.49723530887366, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 123.52553158817301, Y: 210.2772318663665, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 119.30839394709568, Y: 190.72689299165108, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 115.09125630601838, Y: 171.17655411693568, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 110.87411866494105, Y: 151.62621524222027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 93.57069239325028, Y: 149.01041062189728, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 77.47043729741353, Y: 142.15236568179046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 63.59557687723425, Y: 131.48750549179812, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 52.82704179459162, Y: 117.69295414985743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 45.84853858422136, Y: 101.64454340317002, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 43.10314034854517, Y: 84.36120509487176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 44.76515554268518, Y: 66.94027802292783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 50.729060932483435, Y: 50.48783665232645, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 60.616201384604096, Y: 36.048465189843, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.79883111142745, Y: 24.538935745203844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.43996996476608, Y: 16.69000142759603, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 106.54654425700475, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.03243813851444, Y: 13.703213848076416, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 140.78745232770902, Y: 18.75499512515364, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 155.7477919255772, Y: 27.83460049477185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 167.96360796320818, Y: 40.36555548975525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 176.65930439267532, Y: 55.55225553150535, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 181.28278156186468, Y: 72.43047976918888, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 181.54048964904868, Y: 89.92861055774284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.41606647479352, Y: 106.93567168044154, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 169.1713763553327, Y: 122.37186549192268, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 157.32988403942613, Y: 135.2571304982726, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 142.64341933635362, Y: 144.7733665754696, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 146.86055697743092, Y: 164.323705450185, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 151.07769461850825, Y: 183.8740443249004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 155.29483225958558, Y: 203.42438319961582, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 165.23379073091726, Y: 217.82810162595092, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.11623520657068, Y: 235.04817269295341, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.33330432947264, Y: 254.59852634736762, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 182.43584194546108, Y: 261.4511376982088, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.28181180087475, Y: 274.3322478283424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 199.76461687296484, Y: 290.95117825546265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.9092368820792, Y: 308.35254501469797, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 189.04561846936014, Y: 323.44182162538107, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 174.75, Y: 333.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 174.75, Y: 353.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 174.75, Y: 373.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.75, Y: 393.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 393.5356461026786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 413.5356461026786, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 9.566216184436591, Y: 302.0530717930303, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 138.85652836562977, Y: 254.65680745024903, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 121.0, Y: 413.5356461026786, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 107.96323151474508, Y: 234.63551210715121, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 22.898870163588384, Y: 107.24568012152895, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 164.445851362841, Y: 12.180661174385193, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 166.87803349322365, Y: 179.65690668382308, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 189.6336535187672, Y: 340.8011093736982, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '84', X: 188.5, Y: 413.5356461026786, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MALAT1, -3.0 ± 0.7
 kcal/mol, AUC: 0.554', X: 36.25730843648242, Y: 426.3356461026786, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 4.180661174385193, 210.26461687296484, 426.3356461026786)
Updated viewBox: -0.25 -0.8193388256148069 215.51461687296484 432.1549849282934
Updated SVG: /disk1/www/rails/humanrnamap/public/result/8a2c4559-acf0-4ab6-b327-80ff23999d5a/final_image/MALAT1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/8a2c4559-acf0-4ab6-b327-80ff23999d5a/final_image/MALAT1_fold_final_1.svg
