Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  4% [===                                               ] -                     
  9% [=====                                             ] \                     
 14% [========                                          ] |                     
 19% [==========                                        ] /                     
 23% [============                                      ] -                     
 28% [===============                                   ] \                     
 33% [=================                                 ] |                     
 38% [====================                              ] /                     
 42% [======================                            ] -                     
 47% [========================                          ] \                     
 52% [===========================                       ] |                     
 57% [=============================                     ] /                     
 61% [===============================                   ] -                     
 66% [==================================                ] \                     
 71% [====================================              ] |                     
 76% [=======================================           ] /                     
 80% [=========================================         ] -                     
 85% [===========================================       ] \                     
 90% [==============================================    ] |                     
 95% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/8e9a2880-61df-475f-b84c-1b1018a53a55/final_image/ADAR_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.18 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.18 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.18 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.75 MB
Based on canonical annotations, the following gene is in your area of interest: ADAR(-)
write fasta - Elapsed time since the previous call: 1.01 seconds
write fasta - Current memory usage: 172.75 MB
Length of region: 105 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 176.40 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/8e9a2880-61df-475f-b84c-1b1018a53a55/fasta/ADAR.fasta" "/disk1/www/rails/humanrnamap/public/result/8e9a2880-61df-475f-b84c-1b1018a53a55/ct/ADAR.ct" --SHAPE "ADAR.dat"

fold - Elapsed time since the previous call: 0.14 seconds
fold - Current memory usage: 176.40 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/8e9a2880-61df-475f-b84c-1b1018a53a55/ct/ADAR.ct" "/disk1/www/rails/humanrnamap/public/result/8e9a2880-61df-475f-b84c-1b1018a53a55/fold_FE/ADAR.txt" -sh "ADAR.dat"

efn2 - Elapsed time since the previous call: 0.46 seconds
efn2 - Current memory usage: 176.40 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/8e9a2880-61df-475f-b84c-1b1018a53a55/ct/ADAR.ct" 1 "/disk1/www/rails/humanrnamap/public/result/8e9a2880-61df-475f-b84c-1b1018a53a55/fold_dbn/ADAR_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.40 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CUACAGAUAACCUGUAAUUGAGCAGAUUUAAAAUUCAGGCAUACUUUUCCAUUUAUCCAAGUGCUUUCAUUUUUCCAGAUGGCUUCAGAAGUAGGCUCGUGGGCA', '-structureDBN', '((((.......((((......))))............(((.(((((((((((((....(((((....)))))....))))))....))))))).))).))))...', '-o', '/disk1/www/rails/humanrnamap/public/result/8e9a2880-61df-475f-b84c-1b1018a53a55/final_image/ADAR_fold_1.svg', '-title', 'ADAR, -17.3 ± 1.5\n kcal/mol, AUC: 0.691', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,6,8,13,14,15,18,19,20,22,25,27,28,29,34,35,38,39,42,45,46,47,48,52,53,54,56,61,62,63,65,66,67,70,71,72,73,74,78,80,81,82,84,85,88,91,92,94,95,97,99,100,101,102,103', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '96,1,5,104,12,55,23,24,59,31', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,3,4,69,76,77,83,21,86,89,90,93,30,105,43,44,50,58,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '68,7,9,10,11,75,79,16,17,87,26,32,33,98,36,37,40,41,49,51,57']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.70420034485602, Y: 301.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.70420034485602, Y: 281.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.70420034485602, Y: 261.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.70420034485602, Y: 241.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 106.35967460621447, Y: 235.43508703373655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 90.05234531290091, Y: 224.98424948868092, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 76.74251565045728, Y: 210.91309358625273, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 67.21397256486148, Y: 194.0502391203074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 62.027831252482656, Y: 175.3887029466226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 61.489492305494366, Y: 156.02742237813072, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 65.6306573346506, Y: 137.10654115459897, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.20746213031754, Y: 119.74026885537671, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 60.06532650658659, Y: 105.59813323164576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 45.923190882855636, Y: 91.45599760791481, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 31.781055259124685, Y: 77.31386198418386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 14.848706891664904, Y: 72.89291971108719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 58.60077953071834, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 6.237991249216634, Y: 41.16417912062332, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 18.612342784126895, Y: 28.789827585713056, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 36.04894319422198, Y: 27.30183633649642, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 50.34108337459082, Y: 37.40054322816127, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.762025647687494, Y: 54.33289159562116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 68.90416127141845, Y: 68.47502721935211, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 83.0462968951494, Y: 82.61716284308307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 97.18843251888035, Y: 96.75929846681402, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 112.0727505571486, Y: 89.09883707111669, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 128.22749212310293, Y: 84.7113643137634, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.9420500997207, Y: 83.78987426738547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 161.4811924309779, Y: 86.37490099949162, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.11740316113753, Y: 92.35273557911387, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 191.16288406187437, Y: 101.46042785138161, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 202.99980917482685, Y: 113.2973529643341, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.1075014470946, Y: 127.34283386507093, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 218.08533602671687, Y: 142.97904459523056, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 220.67036275882302, Y: 159.51818692648772, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 219.7488727124451, Y: 176.2327449031055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 215.36139995509183, Y: 192.3874864690598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 207.7009385593945, Y: 207.27180450732814, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 221.84307418312545, Y: 221.4139401310591, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 235.9852098068564, Y: 235.55607575479004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 252.14536707703735, Y: 242.27158148269223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 258.8608728049395, Y: 258.4317387528731, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 273.00300842867046, Y: 272.57387437660407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 287.1451440524014, Y: 286.716010000335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 301.28727967613236, Y: 300.85814562406597, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 315.4294152998633, Y: 315.000281247797, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 329.57155092359426, Y: 329.14241687152787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 343.7136865473252, Y: 343.2845524952588, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 361.01598557647924, Y: 345.90775441639266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 378.71442547617517, Y: 336.59296912005584, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 396.4128653758711, Y: 327.2781838237191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 414.111305275567, Y: 317.9633985273823, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 431.80974517526295, Y: 308.6486132310455, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 449.5081850749589, Y: 299.3338279347087, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 452.5670792716846, Y: 282.1032364567965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 462.8914128191084, Y: 267.9731885734027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 478.377551570968, Y: 259.8227515947118, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 495.8701179794027, Y: 259.3126174633635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 511.8049149140585, Y: 266.5467285377629, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 529.50335686403, Y: 257.2319471370274, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 547.2017988140016, Y: 247.917165736292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 564.9002407639731, Y: 238.60238433555654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 582.5986827139446, Y: 229.2876029348211, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 596.1103170195374, Y: 218.16613765417964, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 613.2655791890222, Y: 221.6227590527183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 621.4160295694323, Y: 237.108927403639, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 614.552405302373, Y: 253.20681277772533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 597.7352024901397, Y: 258.0475711035249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 580.0367605401682, Y: 267.36235250426034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 562.3383185901966, Y: 276.6771339049958, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 544.6398766402251, Y: 285.99191530573125, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 526.9414346902536, Y: 295.3066967064667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 523.882538040672, Y: 312.53728437163875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 513.5582052109826, Y: 326.6673286610879, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 498.07206940175297, Y: 334.81776409105703, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 480.579506362118, Y: 335.32789966558533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 464.6447111815062, Y: 328.09379277171456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 446.94627128181025, Y: 337.4085780680514, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 429.2478313821143, Y: 346.72336336438815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 411.5493914824184, Y: 356.0381486607249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 393.8509515827225, Y: 365.3529339570617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 376.15251168302655, Y: 374.66771925339845, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 368.5186856756068, Y: 390.41493172063986, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 353.0325523811781, Y: 398.5653719288241, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 335.7302742563641, Y: 395.9421731769978, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 323.3559080418256, Y: 383.5678020500076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 320.7327161587624, Y: 366.26552288382163, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 306.59058053503145, Y: 352.1233872600907, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 292.4484449113005, Y: 337.98125163635973, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 278.30630928756955, Y: 323.8391160126288, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 264.1641736638386, Y: 309.6969803888978, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 250.0220380401077, Y: 295.5548447651669, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 235.87990241637675, Y: 281.4127091414359, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 219.71974514619583, Y: 274.69720341353377, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 213.00423941829362, Y: 258.5370461433528, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 198.86210379456267, Y: 244.39491051962187, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 184.71996817083172, Y: 230.25277489589092, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 171.49840278381106, Y: 237.24626446134695, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 157.20420034485602, Y: 241.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 157.20420034485602, Y: 261.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 157.20420034485602, Y: 281.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 157.20420034485602, Y: 301.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 174.70420034485602, Y: 301.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 192.20420034485602, Y: 301.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.70420034485602, Y: 301.6501791085193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 125.45420034485602, Y: 321.6501791085193, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 37.827479683675804, Y: 154.15345510292593, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 37.53717896966271, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 182.42906296823705, Y: 74.52336874962725, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 246.37734543058735, Y: 221.4139401310591, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 365.64964017983834, Y: 318.8945292203599, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 516.4385754632947, Y: 239.53350518705585, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 567.9030999909321, Y: 294.37557585496734, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 417.1141767787552, Y: 373.73658856042084, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 260.4141736638386, Y: 337.98125163635973, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '100', X: 168.95420034485602, Y: 261.6501791085193, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '105', X: 201.45420034485602, Y: 321.6501791085193, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ADAR, -17.3 ± 1.5
 kcal/mol, AUC: 0.691', X: 247.08301478471617, Y: 416.3653719288241, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 631.9160295694323, 416.3653719288241)
Updated viewBox: -0.25 -5.0 637.1660295694323 426.3653719288241
Updated SVG: /disk1/www/rails/humanrnamap/public/result/8e9a2880-61df-475f-b84c-1b1018a53a55/final_image/ADAR_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/8e9a2880-61df-475f-b84c-1b1018a53a55/final_image/ADAR_fold_final_1.svg
