Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 20% [===========                                       ] /                     
 26% [==============                                    ] -                     
 31% [================                                  ] \                     
 36% [===================                               ] |                     
 41% [=====================                             ] /                     
 46% [========================                          ] -                     
 52% [===========================                       ] \                     
 57% [=============================                     ] |                     
 62% [================================                  ] /                     
 67% [==================================                ] -                     
 72% [=====================================             ] \                     
 78% [========================================          ] |                     
 83% [==========================================        ] /                     
 88% [=============================================     ] -                     
 93% [===============================================   ] \                     
 98% [==================================================] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/8f60d24b-7e3a-4911-a940-f9d7545b5f79/final_image/BRCA1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.29 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.29 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.29 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.91 MB
Based on canonical annotations, the following gene is in your area of interest: BRCA1(-)
write fasta - Elapsed time since the previous call: 0.59 seconds
write fasta - Current memory usage: 172.91 MB
Length of region: 96 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.45 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/8f60d24b-7e3a-4911-a940-f9d7545b5f79/fasta/BRCA1.fasta" "/disk1/www/rails/humanrnamap/public/result/8f60d24b-7e3a-4911-a940-f9d7545b5f79/ct/BRCA1.ct" --SHAPE "BRCA1.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 176.45 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/8f60d24b-7e3a-4911-a940-f9d7545b5f79/ct/BRCA1.ct" "/disk1/www/rails/humanrnamap/public/result/8f60d24b-7e3a-4911-a940-f9d7545b5f79/fold_FE/BRCA1.txt" -sh "BRCA1.dat"

efn2 - Elapsed time since the previous call: 0.43 seconds
efn2 - Current memory usage: 176.45 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/8f60d24b-7e3a-4911-a940-f9d7545b5f79/ct/BRCA1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/8f60d24b-7e3a-4911-a940-f9d7545b5f79/fold_dbn/BRCA1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.45 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAGUAGGUUCCAGUACUAAUGAAGUGGGCUCCAGUAUUAAUGAAAUAGGUUCCAGUGAUGAAAACAUUCAAGCAGAACUAGGUAGAAACAGAGGGC', '-structureDBN', '.........(((............)))((((..............((.((((..((..((((....)))).)).))))))............))))', '-o', '/disk1/www/rails/humanrnamap/public/result/8f60d24b-7e3a-4911-a940-f9d7545b5f79/final_image/BRCA1_fold_1.svg', '-title', 'BRCA1, -7.0 ± 1.3\n kcal/mol, AUC: 0.611', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,6,7,8,9,13,14,17,20,21,24,25,26,27,28,30,34,35,37,38,41,42,46,48,49,50,51,55,56,57,59,60,67,68,72,75,79,81,82,83,85,91,93,94,95', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '43,29', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '5,39,40,73,74,11,76,77,80,18,54,58,62,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,10,12,15,16,19,22,23,32,33,36,44,45,47,52,53,61,63,64,65,66,69,70,71,78,84,86,87,88,89,90,92,96']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 109.75, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 378.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 358.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 147.90937677557255, Y: 348.56107218592956, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 138.9330543069434, Y: 333.53859629973635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 136.89509968812027, Y: 316.1576904607505, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.15288391549737, Y: 299.4662300144498, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 153.78441413859161, Y: 286.39119076092106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 169.75001218840742, Y: 279.22538126556117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 187.24998781159258, Y: 279.22538126556117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 203.21558586140839, Y: 286.39119076092106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.84711608450263, Y: 299.4662300144498, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 220.10490031187973, Y: 316.1576904607505, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 218.0669456930566, Y: 333.53859629973635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.09062322442747, Y: 348.56107218592956, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 358.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 378.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.25, Y: 378.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 358.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.25, Y: 338.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 195.44928646394513, Y: 333.6934361126109, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.94037714858305, Y: 325.58652587173003, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 166.32944579022592, Y: 314.5869436358489, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 155.14848267577338, Y: 301.1246137617493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 146.83450152739226, Y: 285.72571837051476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 141.71245859531683, Y: 268.9921312473723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 139.98255157485565, Y: 251.5778932937213, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 141.71239477599937, Y: 234.16364900046293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 146.83437638316838, Y: 217.4300431062857, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 155.1483010979697, Y: 202.03111724626424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 166.32921487590477, Y: 188.568746396514, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.94010592314999, Y: 177.56911427967293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 195.44898552838637, Y: 169.46214720214607, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.2496811165375, Y: 164.5647101622136, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.68552881716454, Y: 163.06822201780335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 233.62010293244217, Y: 143.45906276679545, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 233.906117750926, Y: 124.59871887946872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 249.44690153890184, Y: 113.90861058815563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 263.5890371626328, Y: 99.76647496442467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 277.73117278636374, Y: 85.62433934069372, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 291.8733084100947, Y: 71.48220371696277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 296.34996002655544, Y: 54.564524434237114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.6954799239048, Y: 44.541833134836565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 328.12069056274066, Y: 46.15748043561996, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 346.2643343067793, Y: 37.742720089097475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 356.870241676364, Y: 23.001554192554977, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 374.60388703832984, Y: 19.089385318691598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 390.4275461955175, Y: 28.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 410.4275461955175, Y: 28.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 430.4275461955175, Y: 28.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 450.4275461955175, Y: 28.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 467.56399086310864, Y: 24.45126561276095, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 481.13517780964247, Y: 35.4999821200671, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 481.13517780964247, Y: 53.00001787993301, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 467.5639908631087, Y: 64.04873438723916, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 450.4275461955175, Y: 60.5, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 430.4275461955175, Y: 60.5, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 410.4275461955175, Y: 60.5, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 390.4275461955175, Y: 60.5, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 376.3362315768131, Y: 69.0909091685105, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 359.9383198698783, Y: 67.22614117316027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 341.7946761258396, Y: 75.64090151968276, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 331.772000933948, Y: 89.98649254960696, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 314.8542787986575, Y: 94.46317410552558, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 300.71214317492655, Y: 108.60530972925653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 286.5700075511956, Y: 122.74744535298748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 272.42787192746465, Y: 136.88958097671843, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 265.48498671532997, Y: 149.85274570412162, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 261.5504126000523, Y: 169.4619049551294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 277.05939335246416, Y: 177.56878573760787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 290.6703943455242, Y: 188.56836081880633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 301.85141955115506, Y: 202.0307036814378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.16545033992185, Y: 217.4296287102649, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 315.28752667698285, Y: 234.16325754555706, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.01744842509515, Y: 251.57754394338016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 315.28760031486377, Y: 268.99183765617624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.1655947374927, Y: 285.72548815047605, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 301.85162906453013, Y: 301.1244483357873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 290.67066078571844, Y: 314.58683847826217, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 277.05970630546585, Y: 325.58647111469566, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 261.5507598338621, Y: 333.693417478212, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 338.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 358.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 378.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 244.75, Y: 398.5908115817008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 418.5908115817008, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 144.35786437626905, Y: 412.73294720543174, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 211.29398193609728, Y: 270.2639142921467, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 188.5, Y: 358.5908115817008, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 124.63250614297368, Y: 209.7145726320361, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 245.69690153890184, Y: 85.62433934069372, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 406.6775461955175, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 388.8445769293073, Y: 80.38225283509922, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 276.2522355328439, Y: 161.74632134422177, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 300.96775814148765, Y: 328.8233779411212, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '96', X: 241.0, Y: 418.5908115817008, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'BRCA1, -7.0 ± 1.3
 kcal/mol, AUC: 0.611', X: 176.94258890482126, Y: 431.3908115817008, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 491.63517780964247, 431.3908115817008)
Updated viewBox: -0.25 -5.0 496.88517780964247 441.3908115817008
Updated SVG: /disk1/www/rails/humanrnamap/public/result/8f60d24b-7e3a-4911-a940-f9d7545b5f79/final_image/BRCA1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/8f60d24b-7e3a-4911-a940-f9d7545b5f79/final_image/BRCA1_fold_final_1.svg
