Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 27% [==============                                    ] -                     
 32% [=================                                 ] \                     
 38% [====================                              ] |                     
 43% [======================                            ] /                     
 49% [=========================                         ] -                     
 54% [============================                      ] \                     
 60% [===============================                   ] |                     
 65% [=================================                 ] /                     
 71% [====================================              ] -                     
 76% [=======================================           ] \                     
 82% [==========================================        ] |                     
 87% [============================================      ] /                     
 93% [===============================================   ] -                     
 98% [==================================================] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/8fc45f24-a593-457f-a1e4-168ebffa6898/final_image/MAVS_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.11 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.11 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.11 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.71 MB
Based on canonical annotations, the following gene is in your area of interest: MAVS(+)
write fasta - Elapsed time since the previous call: 0.28 seconds
write fasta - Current memory usage: 170.71 MB
Length of region: 91 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 173.86 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/8fc45f24-a593-457f-a1e4-168ebffa6898/fasta/MAVS.fasta" "/disk1/www/rails/humanrnamap/public/result/8fc45f24-a593-457f-a1e4-168ebffa6898/ct/MAVS.ct" --SHAPE "MAVS.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 173.86 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/8fc45f24-a593-457f-a1e4-168ebffa6898/ct/MAVS.ct" "/disk1/www/rails/humanrnamap/public/result/8fc45f24-a593-457f-a1e4-168ebffa6898/fold_FE/MAVS.txt" -sh "MAVS.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 173.86 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/8fc45f24-a593-457f-a1e4-168ebffa6898/ct/MAVS.ct" 1 "/disk1/www/rails/humanrnamap/public/result/8fc45f24-a593-457f-a1e4-168ebffa6898/fold_dbn/MAVS_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 173.86 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AUUCUUUUAUGUAAUCAUACAACAGAUAUUUGCACCUACAUGUGCAGAGCACUGUGAUAGGCCUCAGUGACACAGAAUAAUACGGCAAAGA', '-structureDBN', '.................((..((((...(((((((......)))))))...))))..)).(((....................))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/8fc45f24-a593-457f-a1e4-168ebffa6898/final_image/MAVS_fold_1.svg', '-title', 'MAVS, -17.3 ± 0.9\n kcal/mol, AUC: 0.83', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,5,6,7,8,10,11,12,15,18,25,27,29,30,31,32,37,41,42,43,44,47,49,53,54,55,56,58,60,61,64,67,68,69,75,78,81,84,85,90', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '33,34,35,86,24,45,63', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '70,72,59,74,91,13,46', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,4,9,14,16,17,19,20,21,22,23,26,28,36,38,39,40,48,50,51,52,57,62,65,66,71,73,76,77,79,80,82,83,87,88,89']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 360.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.25, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 340.55111664700235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 291.87031668259823, Y: 326.4616774258713, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 291.87031668259823, Y: 308.96167390200037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 294.87223468086927, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 302.25, Y: 274.87223468086927, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 254.8722346808693, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.25, Y: 234.8722346808693, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 289.7402137466486, Y: 222.63477602719527, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 285.148907661438, Y: 205.7477971725621, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 289.7402137466486, Y: 188.8608183179289, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 176.623359664255, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 156.62335966425493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 136.6233596642549, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.25, Y: 116.62335966425496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 302.25, Y: 96.62335966425496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 76.62335966425496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 302.25, Y: 56.62335966425496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 293.40309990849715, Y: 41.524303051670245, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 296.3683050233931, Y: 24.27736968815111, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 309.7500121168788, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 327.2499878831212, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 340.63169497660687, Y: 24.27736968815111, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 343.59690009150285, Y: 41.52430305167013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 56.62335966425496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 76.62335966425496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 96.62335966425496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 334.75, Y: 116.62335966425496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 136.6233596642549, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 156.62335966425493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 176.62335966425493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 347.2597862533514, Y: 188.8608183179289, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 351.851092338562, Y: 205.7477971725621, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 347.2597862533514, Y: 222.63477602719533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 334.75, Y: 234.8722346808693, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 254.8722346808693, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.75, Y: 274.87223468086927, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 294.87223468086927, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 345.12968331740177, Y: 308.96167390200037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 345.12968331740177, Y: 326.4616774258713, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 340.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.75, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 340.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 320.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 353.5939902580725, Y: 313.8255620019771, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 339.8682205486071, Y: 302.969550674275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 329.6020343572701, Y: 288.79721292959505, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 323.56532889947283, Y: 272.37138195273803, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 322.21081783495157, Y: 254.92388826910062, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 325.6400806867524, Y: 237.76318046441688, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.59594503745507, Y: 222.17620004813043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 345.481772788389, Y: 209.33186920765436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 360.4062041377984, Y: 200.19342924444166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 377.2500037705083, Y: 195.44620373920193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 394.7499962294917, Y: 195.44620373920193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 411.5937958622016, Y: 200.19342924444166, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 426.518227211611, Y: 209.33186920765442, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 438.404054962545, Y: 222.17620004813048, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 446.3599193132476, Y: 237.76318046441693, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 449.78918216504843, Y: 254.92388826910062, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 448.43467110052717, Y: 272.37138195273803, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 442.39796564272984, Y: 288.7972129295951, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 432.1317794513929, Y: 302.969550674275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 418.40600974192745, Y: 313.8255620019771, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 402.25, Y: 320.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 402.25, Y: 340.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 454.75, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 472.25, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 489.75, Y: 360.5511166470024, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 380.55111664700235, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 380.55111664700235, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 269.11973432038775, Y: 332.7049033465678, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 278.5, Y: 156.62335966425493, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 354.2341463777645, Y: 14.332902363529683, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 368.101092338562, Y: 205.7477971725621, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 348.5, Y: 380.5511166470024, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 313.4450014899962, Y: 210.73028152871635, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 464.2249054746761, Y: 276.6350940212681, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 468.5, Y: 380.5511166470024, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '91', X: 486.0, Y: 380.5511166470024, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MAVS, -17.3 ± 0.9
 kcal/mol, AUC: 0.83', X: 185.75, Y: 393.3511166470024, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 504.0, 393.3511166470024)
Updated viewBox: -0.25 0.0 509.25 398.3511166470024
Updated SVG: /disk1/www/rails/humanrnamap/public/result/8fc45f24-a593-457f-a1e4-168ebffa6898/final_image/MAVS_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/8fc45f24-a593-457f-a1e4-168ebffa6898/final_image/MAVS_fold_final_1.svg
