Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 39% [====================                              ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 56% [=============================                     ] \                     
 62% [================================                  ] |                     
 68% [===================================               ] /                     
 73% [=====================================             ] -                     
 79% [========================================          ] \                     
 85% [===========================================       ] |                     
 90% [==============================================    ] /                     
 96% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/90035350-7faf-4c58-943e-1c95929ee62e/final_image/NORAD_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.55 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.55 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.55 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.07 MB
Based on canonical annotations, the following gene is in your area of interest: NORAD(-)
write fasta - Elapsed time since the previous call: 0.29 seconds
write fasta - Current memory usage: 171.07 MB
Length of region: 88 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 174.56 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/90035350-7faf-4c58-943e-1c95929ee62e/fasta/NORAD.fasta" "/disk1/www/rails/humanrnamap/public/result/90035350-7faf-4c58-943e-1c95929ee62e/ct/NORAD.ct" --SHAPE "NORAD.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 174.56 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/90035350-7faf-4c58-943e-1c95929ee62e/ct/NORAD.ct" "/disk1/www/rails/humanrnamap/public/result/90035350-7faf-4c58-943e-1c95929ee62e/fold_FE/NORAD.txt" -sh "NORAD.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 174.56 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/90035350-7faf-4c58-943e-1c95929ee62e/ct/NORAD.ct" 1 "/disk1/www/rails/humanrnamap/public/result/90035350-7faf-4c58-943e-1c95929ee62e/fold_dbn/NORAD_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 174.56 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCACUGCACUCCAGCCUGGCGACAGAGCGAGGCUCCGUUUCAAAAAAAAAAGUGCACAAUGUAGGUUAACAGUAGAGGGCUUAAGUAA', '-structureDBN', '.((.((((((..(((((.((......)).)))))................))))))...))((((((..........)))))).....', '-o', '/disk1/www/rails/humanrnamap/public/result/90035350-7faf-4c58-943e-1c95929ee62e/final_image/NORAD_fold_1.svg', '-title', 'NORAD, -24.3 ± 0.8\n kcal/mol, AUC: 0.679', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,6,10,14,17,18,19,21,25,27,29,31,32,34,37,38,39,40,52,53,54,60,61,62,64,65,66,67,72,73,75,77,78,79,81,82,85,86', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,2,3,4,7,8,9,11,12,15,16,28,33,36,41,42,43,44,45,46,47,55', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '35,80,49,83,20,56,26,30', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '68,69,70,71,74,76,13,84,22,23,24,87,88,48,50,51,57,58,59,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 259.56781016400686, Y: 274.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 277.06781016400686, Y: 274.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.06781016400686, Y: 254.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 266.6881245308536, Y: 240.22277794709606, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 266.68813147811363, Y: 222.72276737548486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 254.82564717004573, Y: 206.62054808618058, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 242.96316286197782, Y: 190.51832879687635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 231.10067855390986, Y: 174.41610950757206, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 219.23819424584195, Y: 158.31389021826783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 207.37570993777405, Y: 142.21167092896354, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 187.55463936700335, Y: 146.9191497793861, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 167.23985228525464, Y: 145.38793407875414, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 148.3483667644254, Y: 137.76251799076613, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 134.2062311406945, Y: 151.90465361449708, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 120.06409551696356, Y: 166.04678923822803, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 105.92195989323261, Y: 180.18892486195898, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 91.77982426950166, Y: 194.33106048568993, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 85.06431854159939, Y: 210.49121775587085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 68.9041612714185, Y: 217.20672348377303, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.76202564768755, Y: 231.348859107504, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 50.34108337459082, Y: 248.28120747496382, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 36.04894319422203, Y: 258.37991436662867, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 18.61234278412695, Y: 256.8919231174121, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 6.237991249216691, Y: 244.51757158250183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 4.75, Y: 227.08097117240675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 14.84870689166496, Y: 212.78883099203793, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 31.78105525912474, Y: 208.36788871894123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 45.92319088285569, Y: 194.22575309521025, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 52.63869661075796, Y: 178.06559582502933, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 68.79885388093885, Y: 171.35009009712712, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 82.9409895046698, Y: 157.20795447339617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 97.08312512840075, Y: 143.06581884966522, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 111.2252607521317, Y: 128.92368322593427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 125.36739637586265, Y: 114.78154760220332, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 118.60373348105327, Y: 99.19348694417846, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 116.02315599125427, Y: 82.39838674644147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 117.79507622902759, Y: 65.49882848286984, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 123.8031694089085, Y: 49.60425119453811, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 133.65301024283838, Y: 35.75811793000793, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 146.69796656451462, Y: 24.869413443318876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.0816500822043, Y: 17.652970257064, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.79413741069982, Y: 14.58254062462521, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 195.73827052808633, Y: 15.859695170155703, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 211.80168409886772, Y: 21.400589979382687, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 225.92983114196898, Y: 30.841470868441263, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 237.19521298179183, Y: 43.562553481012856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.85826860551077, Y: 58.72871150935583, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 248.41592610140572, Y: 75.34430189834848, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.63462882502722, Y: 92.31852781291695, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 242.5656681585275, Y: 108.5370483556286, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 233.54181628289348, Y: 122.9351339283532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 245.40430059096138, Y: 139.03735321765748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 257.2667848990293, Y: 155.1395725069617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 269.1292692070972, Y: 171.24179179626594, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 280.9917535151651, Y: 187.34401108557023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 292.85423782323306, Y: 203.4462303748745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 309.56781923094496, Y: 208.6333487008612, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.9474957971601, Y: 222.72278851870934, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.9474923235322, Y: 240.222788518709, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 309.56781016400686, Y: 254.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 309.56781016400686, Y: 274.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 327.06781016400686, Y: 274.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 327.06781016400686, Y: 254.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 327.06781016400686, Y: 234.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 327.06781016400686, Y: 214.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 327.06781016400686, Y: 194.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 327.06781016400686, Y: 174.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 313.76788288146895, Y: 162.93852442268656, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 307.333908302871, Y: 146.66421694646903, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 309.26082632206203, Y: 129.2706520543651, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.10091577013236, Y: 114.79924050046031, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.5678228396087, Y: 106.61242803084201, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 352.067797488405, Y: 106.61242803084201, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 367.53470455788135, Y: 114.79924050046031, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 377.3747940059517, Y: 129.2706520543651, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 379.3017120251427, Y: 146.66421694646903, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 372.86773744654477, Y: 162.93852442268656, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 359.56781016400686, Y: 174.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 359.56781016400686, Y: 194.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 359.56781016400686, Y: 214.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 359.56781016400686, Y: 234.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 359.56781016400686, Y: 254.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 359.56781016400686, Y: 274.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 377.06781016400686, Y: 274.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 394.56781016400686, Y: 274.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 412.06781016400686, Y: 274.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 429.56781016400686, Y: 274.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 447.06781016400686, Y: 274.31222421596925, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 260.31781016400686, Y: 294.31222421596925, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 195.31657891394946, Y: 160.40393141602001, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 60.31465506959819, Y: 249.0536913811688, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 50.9067182572079, Y: 157.20795447339617, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 132.20446201160578, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 256.98340990455887, Y: 116.89965320397036, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 317.5467366131671, Y: 270.5119860768791, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 286.7491795623632, Y: 122.34240473889756, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 375.81781016400686, Y: 214.31222421596925, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '88', X: 443.31781016400686, Y: 294.31222421596925, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'NORAD, -24.3 ± 0.8
 kcal/mol, AUC: 0.679', X: 159.90890508200343, Y: 307.11222421596926, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 461.31781016400686, 307.11222421596926)
Updated viewBox: -0.25 -5.0 466.56781016400686 317.11222421596926
Updated SVG: /disk1/www/rails/humanrnamap/public/result/90035350-7faf-4c58-943e-1c95929ee62e/final_image/NORAD_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/90035350-7faf-4c58-943e-1c95929ee62e/final_image/NORAD_fold_final_1.svg
