Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/912bd8f5-ca62-4c02-839d-cebace1349cd/final_image/KPNB1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.19 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.19 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.19 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.85 MB
Based on canonical annotations, the following gene is in your area of interest: KPNB1(+)
write fasta - Elapsed time since the previous call: 1.24 seconds
write fasta - Current memory usage: 172.85 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 175.93 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/912bd8f5-ca62-4c02-839d-cebace1349cd/fasta/KPNB1.fasta" "/disk1/www/rails/humanrnamap/public/result/912bd8f5-ca62-4c02-839d-cebace1349cd/ct/KPNB1.ct" --SHAPE "KPNB1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 175.93 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/912bd8f5-ca62-4c02-839d-cebace1349cd/ct/KPNB1.ct" "/disk1/www/rails/humanrnamap/public/result/912bd8f5-ca62-4c02-839d-cebace1349cd/fold_FE/KPNB1.txt" -sh "KPNB1.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 175.93 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/912bd8f5-ca62-4c02-839d-cebace1349cd/ct/KPNB1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/912bd8f5-ca62-4c02-839d-cebace1349cd/fold_dbn/KPNB1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 175.93 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCCAGUCAGCUCAAACCACUAGUUAUACAGGCUAUGCCCACCCUAAUAGAAUUAAUGAAAGACCCCAGUGUAGUUGUUCGAGAUA', '-structureDBN', '.........(((.(((.((((........(((...))).......................((....)).)))).))).)))...', '-o', '/disk1/www/rails/humanrnamap/public/result/912bd8f5-ca62-4c02-839d-cebace1349cd/final_image/KPNB1_fold_1.svg', '-title', 'KPNB1, -2.7 ± 0.6\n kcal/mol, AUC: 0.587', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,6,9,11,20,22,23,24,26,30,31,33,35,36,44,47,49,52,53,56,57,61,68,69,70,71,73,74,75,76,77,78,80,82,84', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '2,85,38,40,72,62', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '64,1,65,66,4,67,12,13,17,18,83,25,29,32,37,54,58,60,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '3,7,8,10,14,15,16,79,81,19,21,27,28,34,39,41,42,43,45,46,48,50,51,55,59']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 8.929984893733149, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 26.42998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 43.92998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 61.42998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 78.92998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 96.42998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 113.92998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 131.42998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 148.92998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.42998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 166.42998489373315, Y: 422.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.42998489373315, Y: 402.8276132248613, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.7516077422439, Y: 386.6520767947785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.42998489373315, Y: 370.4765403646958, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.42998489373315, Y: 350.4765403646957, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.42998489373315, Y: 330.4765403646957, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.7516077422439, Y: 314.301003934613, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.42998489373315, Y: 298.12546750453026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.42998489373315, Y: 278.12546750453026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 166.42998489373315, Y: 258.12546750453026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.42998489373315, Y: 238.12546750453026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 150.69087352356374, Y: 234.6824058100048, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 135.6003164425006, Y: 229.03887964827936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 121.46426292830492, Y: 221.3093071116703, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 108.56931044320623, Y: 211.6503992561232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 97.1768940938336, Y: 200.25798290675056, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 87.51798623828644, Y: 187.3630304216519, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 79.78841370167744, Y: 173.22697690745622, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.14488753995201, Y: 158.13641982639297, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 70.70182584542654, Y: 142.39730845622364, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 50.70182584542654, Y: 142.39730845622364, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 30.70182584542654, Y: 142.39730845622364, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 13.227077958505078, Y: 141.45710731766644, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 126.14730845622364, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 13.227077958505078, Y: 110.83750959478073, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 30.70182584542654, Y: 109.89730845622364, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 50.70182584542654, Y: 109.89730845622364, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 70.70182584542654, Y: 109.89730845622364, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.7017060480371, Y: 92.32628095307177, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 81.44035094141378, Y: 75.61309112728668, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 90.74684131018402, Y: 60.181652886871575, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 102.38512702010395, Y: 46.42336974957459, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 116.06001420159055, Y: 34.68720727092034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 131.42465255694287, Y: 25.270841870141112, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 148.0893328829409, Y: 18.41311055548215, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 165.63137166816307, Y: 14.287953054304921, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 183.6058320517647, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 201.5568092169582, Y: 14.581919077088969, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 219.0289939760964, Y: 18.99358643697633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 235.57922124819802, Y: 26.12310440059366, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 250.78771051294416, Y: 35.78963963488832, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.2687131378926, Y: 47.748009815556316, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 275.6802965197455, Y: 61.69490243974951, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.7330168743821, Y: 77.27656805458378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 291.1972606987191, Y: 94.09779277014115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 294.9090686953139, Y: 111.73192247784641, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 295.7742944414911, Y: 129.7316845196042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 293.77099232236867, Y: 147.6405323265202, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 288.9499741601708, Y: 165.00422528140496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 281.4335204214629, Y: 181.38235009304378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 271.4122786912908, Y: 196.3594914537046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 259.14042808143165, Y: 209.55576864695348, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 270.3978148851519, Y: 226.08668641794935, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.9765860056607, Y: 238.25327051926718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 281.4831198449311, Y: 255.6894630630349, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.0185372381396, Y: 265.5396966444223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 250.247460993137, Y: 260.54147164139385, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 243.53507350728364, Y: 244.37993997399468, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.2776867035634, Y: 227.8490222029988, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.00236911842399, Y: 234.28051017257866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 198.92998489373315, Y: 238.12546750453026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 198.92998489373315, Y: 258.12546750453026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 198.92998489373315, Y: 278.12546750453026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 198.92998489373315, Y: 298.12546750453026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 205.6083620452224, Y: 314.301003934613, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 198.92998489373315, Y: 330.4765403646957, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 198.92998489373315, Y: 350.4765403646957, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 198.92998489373315, Y: 370.4765403646957, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 205.6083620452224, Y: 386.6520767947785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 198.92998489373315, Y: 402.8276132248613, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 198.92998489373315, Y: 422.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 198.92998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 216.42998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 233.92998489373315, Y: 442.82761322486124, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 251.42998489373315, Y: 442.8276132248613, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 9.679984893733149, Y: 462.82761322486124, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 148.5378492700022, Y: 456.9697488485922, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 142.67998489373315, Y: 258.12546750453026, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 54.974442638268116, Y: 158.41424610075728, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 59.79575915689628, Y: 66.68092538400367, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 241.17941546879035, Y: 8.443345690780859, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 295.13868236306814, Y: 191.1454091214598, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 218.14226065308247, Y: 253.39357318482132, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 215.17998489373315, Y: 402.8276132248613, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 247.67998489373315, Y: 462.8276132248613, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KPNB1, -2.7 ± 0.6
 kcal/mol, AUC: 0.587', X: 84.26214722074556, Y: 475.6276132248613, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.44334569078085906, 313.13868236306814, 475.6276132248613)
Updated viewBox: -0.25 -4.556654309219141 318.38868236306814 485.18426753408045
Updated SVG: /disk1/www/rails/humanrnamap/public/result/912bd8f5-ca62-4c02-839d-cebace1349cd/final_image/KPNB1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/912bd8f5-ca62-4c02-839d-cebace1349cd/final_image/KPNB1_fold_final_1.svg
