Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/944b38fd-a799-4e08-9fec-c82cd00c579d/final_image/NORAD_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.12 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.12 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.12 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 171.79 MB
Based on canonical annotations, the following gene is in your area of interest: NORAD(-)
write fasta - Elapsed time since the previous call: 0.27 seconds
write fasta - Current memory usage: 171.79 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 174.90 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/944b38fd-a799-4e08-9fec-c82cd00c579d/fasta/NORAD.fasta" "/disk1/www/rails/humanrnamap/public/result/944b38fd-a799-4e08-9fec-c82cd00c579d/ct/NORAD.ct" --SHAPE "NORAD.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 174.90 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/944b38fd-a799-4e08-9fec-c82cd00c579d/ct/NORAD.ct" "/disk1/www/rails/humanrnamap/public/result/944b38fd-a799-4e08-9fec-c82cd00c579d/fold_FE/NORAD.txt" -sh "NORAD.dat"

efn2 - Elapsed time since the previous call: 0.40 seconds
efn2 - Current memory usage: 174.90 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/944b38fd-a799-4e08-9fec-c82cd00c579d/ct/NORAD.ct" 1 "/disk1/www/rails/humanrnamap/public/result/944b38fd-a799-4e08-9fec-c82cd00c579d/fold_dbn/NORAD_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 174.90 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AACUCCACCCCAACCUUUUAAUAGAAAACAUUUGUCACAUCUAGCCCUUCUAGAUGGAAAGAGGUUGCCGACGUAUGAUAAAAUA', '-structureDBN', '..........(((((((((...............((.(((((((.....))))))))))))))))))..................', '-o', '/disk1/www/rails/humanrnamap/public/result/944b38fd-a799-4e08-9fec-c82cd00c579d/final_image/NORAD_fold_1.svg', '-title', 'NORAD, -13.5 ± 1.0\n kcal/mol, AUC: 0.645', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,16,17,18,19,22,24,31,32,33,34,35,40,42,44,48,49,51,53,55,56,57,61,63,64,65,66,67,70,73,74,76,77,79,84', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '81,7,9,28,41', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '3,5,6,10,12,13,14,15,20,39,43,46,47,50,52,58', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,68,69,71,8,72,11,75,78,80,82,83,21,85,23,25,26,27,29,30,36,37,38,45,54,59,60,62']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 127.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 270.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 250.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 230.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 210.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 190.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 170.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 150.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 130.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 163.6251702105468, Y: 123.38794131952787, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 150.5497903685084, Y: 111.30226630593822, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 141.75545664384282, Y: 95.8203803456652, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 138.0705249132801, Y: 78.40055323146052, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 139.8420862640961, Y: 60.68359330804299, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 146.9032737906354, Y: 44.3382964535121, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 158.58898012178508, Y: 30.904258859035224, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 173.79850521406138, Y: 21.64685938536519, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 191.09923348942178, Y: 17.438070997974535, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 208.8615747609019, Y: 18.67432789003368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 225.4124585904936, Y: 25.239184553133725, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 239.19292413880248, Y: 36.51428401254253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 248.90496180346355, Y: 51.43760210698434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 253.63377533880077, Y: 68.60348166777885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 252.93394834323158, Y: 86.39503417800015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 246.87139892068785, Y: 103.13643773465876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 261.0135345444188, Y: 117.2785733583897, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 275.7882836233032, Y: 126.65722248730626, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 277.98736334973734, Y: 144.01856800498157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.7662472965451, Y: 162.83469758669193, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 291.5451312433528, Y: 181.65082716840223, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 298.3240151901605, Y: 200.46695675011253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 305.1028991369682, Y: 219.28308633182283, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 311.8817830837759, Y: 238.09921591353313, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 318.66066703058357, Y: 256.9153454952434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 330.4021503947358, Y: 269.8918001823681, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 329.54998295488053, Y: 287.371062709492, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 316.6018996353318, Y: 299.14382560473837, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 299.1206316197204, Y: 298.33384017028254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 287.3166577479125, Y: 285.4142036169061, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 288.0844564603043, Y: 267.93103190880583, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 281.3055725134966, Y: 249.11490232709556, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 274.5266885666889, Y: 230.29877274538526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.7478046198812, Y: 211.48264316367496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 260.9689206730735, Y: 192.66651358196467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 254.19003672626582, Y: 173.85038400025437, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.41115277945812, Y: 155.03425441854407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 238.032564155856, Y: 140.25954374695252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 223.89042853212507, Y: 126.11740812322157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 130.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 150.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 170.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 190.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 210.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 230.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 250.93903149306252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 270.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 264.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 369.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 387.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 422.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 474.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 492.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 509.75, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 527.25, Y: 290.93903149306254, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 310.93903149306254, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 310.93903149306254, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 148.71438026778105, Y: 139.98422909280592, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 231.80201064879464, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 306.6112608250631, Y: 174.8719432215946, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 265.5265197043619, Y: 274.7326137089808, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 228.5, Y: 150.93903149306252, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 261.0, Y: 310.93903149306254, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 436.0, Y: 310.93903149306254, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 523.5, Y: 310.93903149306254, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'NORAD, -13.5 ± 1.0
 kcal/mol, AUC: 0.645', X: 200.0, Y: 323.73903149306256, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 541.5, 323.73903149306256)
Updated viewBox: -0.25 -5.0 546.75 333.73903149306256
Updated SVG: /disk1/www/rails/humanrnamap/public/result/944b38fd-a799-4e08-9fec-c82cd00c579d/final_image/NORAD_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/944b38fd-a799-4e08-9fec-c82cd00c579d/final_image/NORAD_fold_final_1.svg
