Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 16% [=========                                         ] |                     
 22% [============                                      ] /                     
 27% [==============                                    ] -                     
 33% [=================                                 ] \                     
 38% [====================                              ] |                     
 44% [=======================                           ] /                     
 50% [==========================                        ] -                     
 55% [============================                      ] \                     
 61% [===============================                   ] |                     
 66% [==================================                ] /                     
 72% [=====================================             ] -                     
 77% [=======================================           ] \                     
 83% [==========================================        ] |                     
 88% [=============================================     ] /                     
 94% [================================================  ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/95b29762-70ed-4608-9757-b4080c9adc1d/final_image/TEX2_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.56 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.56 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.56 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.16 MB
Based on canonical annotations, the following gene is in your area of interest: TEX2(-)
write fasta - Elapsed time since the previous call: 0.59 seconds
write fasta - Current memory usage: 172.16 MB
Length of region: 90 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 175.27 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/95b29762-70ed-4608-9757-b4080c9adc1d/fasta/TEX2.fasta" "/disk1/www/rails/humanrnamap/public/result/95b29762-70ed-4608-9757-b4080c9adc1d/ct/TEX2.ct" --SHAPE "TEX2.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 175.27 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/95b29762-70ed-4608-9757-b4080c9adc1d/ct/TEX2.ct" "/disk1/www/rails/humanrnamap/public/result/95b29762-70ed-4608-9757-b4080c9adc1d/fold_FE/TEX2.txt" -sh "TEX2.dat"

efn2 - Elapsed time since the previous call: 0.51 seconds
efn2 - Current memory usage: 175.27 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/95b29762-70ed-4608-9757-b4080c9adc1d/ct/TEX2.ct" 1 "/disk1/www/rails/humanrnamap/public/result/95b29762-70ed-4608-9757-b4080c9adc1d/fold_dbn/TEX2_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.27 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGCACCUUGCCUGAACAUGACUUUAAAGAAAUUAAUAUAUUGAAAACAUGUUUGAACCCUUAUUUUAAUUGCACCAUUAAAACAUUUGAC', '-structureDBN', '.(((...))).((((((((..(((((.............)))))..))))))))........(((((((......)))))))........', '-o', '/disk1/www/rails/humanrnamap/public/result/95b29762-70ed-4608-9757-b4080c9adc1d/final_image/TEX2_fold_1.svg', '-title', 'TEX2, -5.4 ± 1.0\n kcal/mol, AUC: 0.578', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,7,8,9,12,13,18,19,22,23,24,28,32,33,36,38,40,41,42,49,50,51,52,53,54,60,61,63,64,65,66,69,70,71,77,78,85,86,87,88', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '67,6,73,75,80,89,29,62', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '34,3,72,11,44,76,15,79,17,82,55,26,30', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,4,5,68,10,74,14,16,81,83,20,21,84,25,90,27,31,35,37,39,43,45,46,47,48,56,57,58,59']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 344.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 324.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 23.190201138557143, Y: 307.2199868856827, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 38.5, Y: 298.7429089271777, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 53.80979886144286, Y: 307.2199868856828, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 54.75, Y: 324.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.75, Y: 344.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.75, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 72.25, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 344.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 324.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 304.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 284.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 264.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 244.69473477260422, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 89.75, Y: 224.69473477260422, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 79.37031668259823, Y: 210.60529555147318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 79.37031668259823, Y: 193.1052920276022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 179.01585280647114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 159.01585280647114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 89.75, Y: 139.01585280647117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 119.01585280647112, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 99.01585280647112, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 75.02773195655544, Y: 89.55519616200161, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 65.0861604791117, Y: 75.15330888822905, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 61.4598078879651, Y: 58.03318133694427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 64.70841657444728, Y: 40.83737539218885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.33055046774936, Y: 26.220134208335367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 88.84099374845553, Y: 16.437688896196732, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 105.99999999999999, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 123.15900625154441, Y: 16.437688896196732, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 137.6694495322506, Y: 26.220134208335367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 147.2915834255527, Y: 40.83737539218873, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 150.5401921120349, Y: 58.03318133694427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 146.9138395208883, Y: 75.15330888822905, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 136.97226804344456, Y: 89.55519616200161, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.25, Y: 99.01585280647112, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.25, Y: 119.01585280647112, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 122.25, Y: 139.01585280647117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 122.25, Y: 159.01585280647114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 122.25, Y: 179.0158528064711, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 132.62968331740177, Y: 193.1052920276022, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 132.62968331740177, Y: 210.60529555147318, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 122.25, Y: 224.69473477260422, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 122.25, Y: 244.69473477260422, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.25, Y: 264.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 122.25, Y: 284.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.25, Y: 304.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.25, Y: 324.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.25, Y: 344.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 122.25, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 139.75, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 157.25, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.75, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 192.25, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.75, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 364.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.25, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.75, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.75, Y: 344.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.75, Y: 324.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.75, Y: 304.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.75, Y: 284.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.75, Y: 264.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.75, Y: 244.69473477260422, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 270.90309990849715, Y: 229.59567816001945, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 273.86830502339313, Y: 212.34874479650037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 287.2500121168788, Y: 201.07137510834932, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 304.7499878831212, Y: 201.07137510834932, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 318.1316949766069, Y: 212.34874479650037, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 321.09690009150285, Y: 229.59567816001945, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 312.25, Y: 244.69473477260422, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 312.25, Y: 264.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 312.25, Y: 284.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 312.25, Y: 304.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 312.25, Y: 324.6947347726042, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 312.25, Y: 344.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 312.25, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 329.75, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 347.25, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 364.75, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 382.25, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 399.75, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 417.25, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 434.75, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 452.25, Y: 364.69473477260425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 384.6947347726042, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 65.14213562373095, Y: 378.83687039633514, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 56.619734320387764, Y: 216.8485214721697, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 42.41827114746748, Y: 33.336508272552635, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 136.91377656067598, Y: 106.82180135699974, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 138.5, Y: 284.6947347726042, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 223.5, Y: 384.6947347726042, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 247.4757665809854, Y: 233.17374371531537, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 328.5, Y: 324.6947347726042, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 448.5, Y: 384.69473477260425, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TEX2, -5.4 ± 1.0
 kcal/mol, AUC: 0.578', X: 162.5, Y: 397.49473477260426, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 466.5, 397.49473477260426)
Updated viewBox: -0.25 0.0 471.75 402.49473477260426
Updated SVG: /disk1/www/rails/humanrnamap/public/result/95b29762-70ed-4608-9757-b4080c9adc1d/final_image/TEX2_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/95b29762-70ed-4608-9757-b4080c9adc1d/final_image/TEX2_fold_final_1.svg
