Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 53% [===========================                       ] -                     
 59% [==============================                    ] \                     
 65% [=================================                 ] |                     
 71% [====================================              ] /                     
 77% [=======================================           ] -                     
 83% [==========================================        ] \                     
 89% [=============================================     ] |                     
 95% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/9638b01d-6f5c-4476-8d6b-1eb4c1544ebf/final_image/TEX2_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.45 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.45 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.45 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.10 MB
Based on canonical annotations, the following gene is in your area of interest: TEX2(-)
write fasta - Elapsed time since the previous call: 0.59 seconds
write fasta - Current memory usage: 172.10 MB
Length of region: 84 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 175.24 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/9638b01d-6f5c-4476-8d6b-1eb4c1544ebf/fasta/TEX2.fasta" "/disk1/www/rails/humanrnamap/public/result/9638b01d-6f5c-4476-8d6b-1eb4c1544ebf/ct/TEX2.ct" --SHAPE "TEX2.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 175.24 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/9638b01d-6f5c-4476-8d6b-1eb4c1544ebf/ct/TEX2.ct" "/disk1/www/rails/humanrnamap/public/result/9638b01d-6f5c-4476-8d6b-1eb4c1544ebf/fold_FE/TEX2.txt" -sh "TEX2.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 175.24 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/9638b01d-6f5c-4476-8d6b-1eb4c1544ebf/ct/TEX2.ct" 1 "/disk1/www/rails/humanrnamap/public/result/9638b01d-6f5c-4476-8d6b-1eb4c1544ebf/fold_dbn/TEX2_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 175.24 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACCCUAAGAAGCCACCCCGCCCUCAGGAGGGAACAAGAUCUAGCCAGCGAGAUCAGAUACUCUAUCUCUUUGGGAGAACUGGCC', '-structureDBN', '..........((((.(((.((....)).))).......(((..((((.(((((.(((...)))))))).)))).)))..)))).', '-o', '/disk1/www/rails/humanrnamap/public/result/9638b01d-6f5c-4476-8d6b-1eb4c1544ebf/final_image/TEX2_fold_1.svg', '-title', 'TEX2, -25.0 ± 1.1\n kcal/mol, AUC: 0.833', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,8,11,19,23,26,27,29,30,31,37,39,41,43,47,49,51,53,56,58,61,63,65,67,69,70,71,72,73,74,76,80,81,82', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '45,15,16,17,50,83,20,21,22,52', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '66,4,68,9,75,12,13,77,79,18,84,24,25,38,40,44,46,55,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,2,3,6,7,10,14,78,28,32,33,34,35,36,42,48,54,57,59,60']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 154.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 134.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 114.49176271701855, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.75885827069789, Y: 105.12329942705813, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 150.3674005983738, Y: 90.19283465078385, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 130.72293998112954, Y: 93.94718773188055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 111.07847936388532, Y: 97.70154081297727, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 96.44418370180492, Y: 107.29762286942304, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 79.30257710842432, Y: 103.77445330821888, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 59.658129649196724, Y: 107.52887523731084, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 43.4925026138726, Y: 114.23139373048826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 28.088501990178145, Y: 105.92669527829815, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 24.80337608934144, Y: 88.73776862733362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 36.059222358700794, Y: 75.33787398755618, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 53.55719401442224, Y: 75.60664811606603, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 73.20164147364983, Y: 71.85222618697404, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 87.8359824328275, Y: 62.256077756976964, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 104.97765560710315, Y: 65.7792923099554, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.6221162243474, Y: 62.02493922885867, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 144.26657684159164, Y: 58.27058614776195, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 149.38008550511464, Y: 41.53433719083989, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.74133918341278, Y: 27.43134381305117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 174.1840290591871, Y: 17.54910170145496, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 191.08242169605703, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.5343588279971, Y: 14.296105837812775, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 224.57537275757383, Y: 21.291523774657094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 237.39981558103352, Y: 33.19881844086129, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 245.5641109507303, Y: 48.67765176628825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 265.5641109507303, Y: 48.67765176628825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 285.5641109507303, Y: 48.67765176628825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 300.69218740849396, Y: 39.880516738542866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.9231147911018, Y: 42.93721815405965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 329.1021642350369, Y: 56.401137922774126, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 347.88179186496524, Y: 63.28049734653109, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 366.66141949489355, Y: 70.15985677028806, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 385.44104712482186, Y: 77.03921619404505, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.9266847810546, Y: 76.33219701880239, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 415.8180682351875, Y: 88.16687627080296, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 434.5977199751185, Y: 95.04616987748295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 453.37737171504943, Y: 101.92546348416292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.1570234549804, Y: 108.80475709084288, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 490.93667519491134, Y: 115.68405069752286, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 508.2397847171253, Y: 117.94622099317716, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 517.5721129855377, Y: 132.6914799829293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 531.7142486092687, Y: 146.83361560666026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 545.8563842329996, Y: 160.9757512303912, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 557.548074362614, Y: 173.9970865615117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 552.7166110781917, Y: 190.816948464146, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 535.8967491755574, Y: 195.64841174856838, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 522.8754138444368, Y: 183.956721618954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 508.73327822070587, Y: 169.81458599522307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 494.59114259697503, Y: 155.67245037149212, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 479.7578230840563, Y: 146.2009847749107, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 460.97817134412537, Y: 139.3216911682307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 442.1985196041944, Y: 132.4423975615507, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 423.41886786426346, Y: 125.56310395487075, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 404.6392161243325, Y: 118.68381034819076, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.1535054921134, Y: 119.39086316538258, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 374.26208806121673, Y: 107.55611109267852, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 355.4824604312884, Y: 100.67675166892155, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 336.7028328013601, Y: 93.79739224516456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.9232051714318, Y: 86.91803282140756, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 300.6922388802268, Y: 89.9747959249791, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 285.5641109507303, Y: 81.17765176628825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 265.5641109507303, Y: 81.17765176628825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 245.5641109507303, Y: 81.17765176628825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.17115513069734, Y: 95.62386112964393, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 226.69620936335568, Y: 107.0988068969856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 114.49176271701855, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 134.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 154.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.25, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 174.49176271701856, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 194.49176271701856, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 194.49176271701856, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 79.30698182552162, Y: 123.41890405697328, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 117.1177631432507, Y: 42.38047861161442, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 261.8141109507303, Y: 28.67765176628825, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 437.7270135817985, Y: 76.266518137552, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 527.6658105902249, Y: 215.13997888398563, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 363.6327450917214, Y: 126.33574475012921, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 226.3241474595772, Y: 123.5636846379374, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '84', X: 226.0, Y: 194.49176271701856, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TEX2, -25.0 ± 1.1
 kcal/mol, AUC: 0.833', X: 215.149037181307, Y: 227.93997888398565, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 568.048074362614, 227.93997888398565)
Updated viewBox: -0.25 0.0 573.298074362614 232.93997888398565
Updated SVG: /disk1/www/rails/humanrnamap/public/result/9638b01d-6f5c-4476-8d6b-1eb4c1544ebf/final_image/TEX2_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/9638b01d-6f5c-4476-8d6b-1eb4c1544ebf/final_image/TEX2_fold_final_1.svg
