Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 20% [===========                                       ] |                     
 26% [==============                                    ] /                     
 33% [=================                                 ] -                     
 40% [=====================                             ] \                     
 46% [========================                          ] |                     
 53% [===========================                       ] /                     
 60% [===============================                   ] -                     
 66% [==================================                ] \                     
 73% [=====================================             ] |                     
 80% [=========================================         ] /                     
 86% [============================================      ] -                     
 93% [===============================================   ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/96a6d59f-429f-408e-b489-232f63b9a2a8/final_image/HCFC1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.12 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.12 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.12 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.74 MB
Based on canonical annotations, the following gene is in your area of interest: HCFC1(-)
write fasta - Elapsed time since the previous call: 0.28 seconds
write fasta - Current memory usage: 172.74 MB
Length of region: 75 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.22 seconds
write dat - Current memory usage: 176.26 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/96a6d59f-429f-408e-b489-232f63b9a2a8/fasta/HCFC1.fasta" "/disk1/www/rails/humanrnamap/public/result/96a6d59f-429f-408e-b489-232f63b9a2a8/ct/HCFC1.ct" --SHAPE "HCFC1.dat"

fold - Elapsed time since the previous call: 0.13 seconds
fold - Current memory usage: 176.26 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/96a6d59f-429f-408e-b489-232f63b9a2a8/ct/HCFC1.ct" "/disk1/www/rails/humanrnamap/public/result/96a6d59f-429f-408e-b489-232f63b9a2a8/fold_FE/HCFC1.txt" -sh "HCFC1.dat"

efn2 - Elapsed time since the previous call: 0.44 seconds
efn2 - Current memory usage: 176.26 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/96a6d59f-429f-408e-b489-232f63b9a2a8/ct/HCFC1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/96a6d59f-429f-408e-b489-232f63b9a2a8/fold_dbn/HCFC1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.26 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCGACAGCUACCUUCUCCAGCUCCAGAAAUAUGACAUUCCUGCCACGGCUGCUACUGCCACCUCCCCUACACCCA', '-structureDBN', '.....((((.........)))).(((((........))).))....(((.......)))................', '-o', '/disk1/www/rails/humanrnamap/public/result/96a6d59f-429f-408e-b489-232f63b9a2a8/final_image/HCFC1_fold_1.svg', '-title', 'HCFC1, -8.1 ± 0.6\n kcal/mol, AUC: 0.605', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,68,7,9,13,14,16,20,22,26,30,32,33,37,38,41,42,47,48,50,51,53,56,57,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,1,2,65,8,59,73,15,49,18,19,27', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '71,40,44,17,52,21,23,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '66,67,4,5,6,69,70,72,10,11,12,74,75,24,25,28,29,31,34,35,36,39,43,45,46,54,55,58,61,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 127.44185486921326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 107.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 87.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 79.67225050021045, Y: 75.27428758512679, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.92539153751602, Y: 58.43039236814937, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 79.29887974925018, Y: 41.48571541773063, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 91.6046824916709, Y: 29.043179705229846, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 108.5, Y: 24.482727711734498, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 125.3953175083291, Y: 29.043179705229846, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 137.70112025074982, Y: 41.48571541773066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.07460846248398, Y: 58.43039236814937, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 137.32774949978955, Y: 75.27428758512676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 87.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 107.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 127.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 142.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 127.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 155.93439675932206, Y: 110.36275326605744, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 147.4229049137529, Y: 92.264286298858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 138.91141306818372, Y: 74.16581933165858, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 122.80897051784828, Y: 67.31294745430816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 113.02142878604764, Y: 52.805896206639176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 112.6956389967857, Y: 35.30891446499456, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 121.93634777517235, Y: 20.447561554600412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 137.77251953303957, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 155.11257190356602, Y: 15.36073989283733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 168.38140086291014, Y: 26.77076562032383, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 173.3128657938358, Y: 43.561571517876274, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 168.3214218898828, Y: 60.33464508260866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 176.83291373545197, Y: 78.4331120498081, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 185.34440558102114, Y: 96.53157901700753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 196.06563449224356, Y: 110.36289314955357, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.25, Y: 127.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 192.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 244.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 262.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 279.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 279.75, Y: 127.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.75, Y: 107.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 269.2979233435556, Y: 93.40603334012931, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 269.1508797232032, Y: 75.9066456193489, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.36561713592346, Y: 61.69716526228942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 296.0, Y: 56.261404123331744, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 312.63438286407654, Y: 61.69716526228942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 322.8491202767968, Y: 75.9066456193489, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 322.7020766564444, Y: 93.40603334012931, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 312.25, Y: 107.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 312.25, Y: 127.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 312.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 329.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 347.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 364.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 382.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 399.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 417.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 434.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 452.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 469.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 487.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 504.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 522.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 539.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 557.25, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 574.75, Y: 147.44185486921327, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 592.25, Y: 147.4418548692133, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 167.44185486921327, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 58.75094697971625, Y: 85.52837630168582, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 141.0, Y: 107.44185486921327, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 90.2009384844072, Y: 58.832205164453896, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 211.8344630859885, Y: 106.00223605136232, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 246.59007590939115, Y: 99.77784789039228, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 326.0, Y: 167.44185486921327, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 501.0, Y: 167.44185486921327, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '75', X: 588.5, Y: 167.4418548692133, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'HCFC1, -8.1 ± 0.6
 kcal/mol, AUC: 0.605', X: 232.5, Y: 180.2418548692133, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 606.5, 180.2418548692133)
Updated viewBox: -0.25 0.0 611.75 185.2418548692133
Updated SVG: /disk1/www/rails/humanrnamap/public/result/96a6d59f-429f-408e-b489-232f63b9a2a8/final_image/HCFC1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/96a6d59f-429f-408e-b489-232f63b9a2a8/final_image/HCFC1_fold_final_1.svg
