Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  7% [====                                              ] -                     
 15% [========                                          ] \                     
 23% [============                                      ] |                     
 31% [================                                  ] /                     
 39% [====================                              ] -                     
 47% [========================                          ] \                     
 55% [============================                      ] |                     
 63% [================================                  ] /                     
 71% [====================================              ] -                     
 79% [========================================          ] \                     
 87% [============================================      ] |                     
 95% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/96b70ffe-8045-4ec3-af09-73793dbea02f/final_image/KPNB1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.41 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.41 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.41 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 173.00 MB
Based on canonical annotations, the following gene is in your area of interest: KPNB1(+)
write fasta - Elapsed time since the previous call: 0.61 seconds
write fasta - Current memory usage: 173.00 MB
Length of region: 63 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 176.43 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/96b70ffe-8045-4ec3-af09-73793dbea02f/fasta/KPNB1.fasta" "/disk1/www/rails/humanrnamap/public/result/96b70ffe-8045-4ec3-af09-73793dbea02f/ct/KPNB1.ct" --SHAPE "KPNB1.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 176.43 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/96b70ffe-8045-4ec3-af09-73793dbea02f/ct/KPNB1.ct" "/disk1/www/rails/humanrnamap/public/result/96b70ffe-8045-4ec3-af09-73793dbea02f/fold_FE/KPNB1.txt" -sh "KPNB1.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 176.43 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/96b70ffe-8045-4ec3-af09-73793dbea02f/ct/KPNB1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/96b70ffe-8045-4ec3-af09-73793dbea02f/fold_dbn/KPNB1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.43 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAAAACAAAAAAAUCACAACCCAAACAAACCAAAAUUUAAAUGAUCAGAAUUGGCAGCACAAA', '-structureDBN', '.............................((((.................)))).........', '-o', '/disk1/www/rails/humanrnamap/public/result/96b70ffe-8045-4ec3-af09-73793dbea02f/final_image/KPNB1_fold_1.svg', '-title', 'KPNB1, -0.8 ± 0.3\n kcal/mol, AUC: 0.62', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '36,37,38,42,43,45,14,48,51,52,53,54,57', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '32,1,33,23,7,8,9', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,3,34,5,6,35,39,10,11,12,13,22,27,61,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '4,15,16,17,18,19,20,21,24,25,26,28,29,30,40,41,44,46,47,49,50,55,56,58,59,60,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 337.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 354.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 372.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 389.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 407.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 424.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 442.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 459.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 477.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 494.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 512.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 512.25, Y: 162.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 512.25, Y: 142.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 512.25, Y: 122.14644896648635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 496.52803121469833, Y: 114.46071350821758, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 483.97428640652726, Y: 102.26832558329458, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 475.8327638907333, Y: 86.77747527915349, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 472.9102380958197, Y: 69.52320986452179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 475.49631321724297, Y: 52.21532011773735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 483.3347252363131, Y: 36.56891065614565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 495.6487360963838, Y: 24.13444369698135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 511.21810363084035, Y: 16.144097859816213, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 528.5, Y: 13.389666901139549, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 545.7818963691597, Y: 16.144097859816213, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 561.3512639036161, Y: 24.13444369698135, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 573.665274763687, Y: 36.568910656145704, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 581.5036867827571, Y: 52.215320117737406, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 584.0897619041804, Y: 69.52320986452179, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 581.1672361092667, Y: 86.77747527915349, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 573.0257135934728, Y: 102.26832558329458, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 560.4719687853017, Y: 114.46071350821761, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 544.75, Y: 122.14644896648635, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 544.75, Y: 142.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 544.75, Y: 162.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 544.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 562.25, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 579.75, Y: 182.14644896648633, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 597.25, Y: 182.14644896648636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 614.75, Y: 182.14644896648636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 632.25, Y: 182.14644896648636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 649.75, Y: 182.14644896648636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 667.25, Y: 182.14644896648636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 684.75, Y: 182.14644896648636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 702.25, Y: 182.14644896648636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 202.14644896648633, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 202.14644896648633, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 202.14644896648633, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 494.35786437626905, Y: 196.28858459021728, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 480.08011830118716, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 568.2242501082386, Y: 130.8221781238324, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 646.0, Y: 202.14644896648636, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '63', X: 698.5, Y: 202.14644896648636, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'KPNB1, -0.8 ± 0.3
 kcal/mol, AUC: 0.62', X: 292.0, Y: 214.94644896648637, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 0.0, 716.5, 214.94644896648637)
Updated viewBox: -0.25 -5.0 721.75 224.94644896648637
Updated SVG: /disk1/www/rails/humanrnamap/public/result/96b70ffe-8045-4ec3-af09-73793dbea02f/final_image/KPNB1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/96b70ffe-8045-4ec3-af09-73793dbea02f/final_image/KPNB1_fold_final_1.svg
