Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 16% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 33% [=================                                 ] \                     
 39% [====================                              ] |                     
 44% [=======================                           ] /                     
 50% [==========================                        ] -                     
 56% [=============================                     ] \                     
 61% [===============================                   ] |                     
 67% [==================================                ] /                     
 73% [=====================================             ] -                     
 78% [========================================          ] \                     
 84% [===========================================       ] |                     
 89% [=============================================     ] /                     
 95% [================================================  ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/99133984-2538-4c32-aecd-e47fe11d48ae/final_image/IDS_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.30 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.30 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.30 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.95 MB
Based on canonical annotations, the following gene is in your area of interest: IDS(-)
write fasta - Elapsed time since the previous call: 0.26 seconds
write fasta - Current memory usage: 172.95 MB
Length of region: 89 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.05 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/99133984-2538-4c32-aecd-e47fe11d48ae/fasta/IDS.fasta" "/disk1/www/rails/humanrnamap/public/result/99133984-2538-4c32-aecd-e47fe11d48ae/ct/IDS.ct" --SHAPE "IDS.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 176.05 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/99133984-2538-4c32-aecd-e47fe11d48ae/ct/IDS.ct" "/disk1/www/rails/humanrnamap/public/result/99133984-2538-4c32-aecd-e47fe11d48ae/fold_FE/IDS.txt" -sh "IDS.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 176.05 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/99133984-2538-4c32-aecd-e47fe11d48ae/ct/IDS.ct" 1 "/disk1/www/rails/humanrnamap/public/result/99133984-2538-4c32-aecd-e47fe11d48ae/fold_dbn/IDS_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.05 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CUUUCUUUCCAAGUAGUUUACCCACCCCUCCUCUUUCCUCCCCUGUCCCUAAAAUAAUCCACGUGUCUUCCUAAAAUCUCUCUUUGAUC', '-structureDBN', '............(((...))).(((.....................................)))..........(((.......))).', '-o', '/disk1/www/rails/humanrnamap/public/result/99133984-2538-4c32-aecd-e47fe11d48ae/final_image/IDS_fold_1.svg', '-title', 'IDS, -1.4 ± 0.5\n kcal/mol, AUC: 0.61', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,6,7,8,13,14,16,17,18,19,29,32,34,35,36,39,44,45,46,50,55,58,63,64,65,66,68,69,72,77,79,81,83,84,85,86,88', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '67,70,71,9,10,74,15,20,21,22,24,25,26,27,31,37,40,41,42,47,48,49,51,52,60', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '5,73,11,12,75,76,78,87,89,30,38,53,54,57,59,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,33,43,80,82,23,56,28,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 22.25, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 254.08321137147053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 234.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 215.69020113855714, Y: 216.60846348454908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 231.0, Y: 208.131385526044, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 246.30979886144286, Y: 216.60846348454908, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 247.25, Y: 234.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 254.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 274.0832113714705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.25, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 254.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.25, Y: 234.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 265.1932623259886, Y: 230.1694430246376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 248.9623278569983, Y: 223.62676398497354, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 233.95962440917185, Y: 214.61739264123992, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 220.55712718802027, Y: 203.36470625132668, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.0871360803966, Y: 190.14770255367466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 199.83403665149626, Y: 175.29408233126426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 193.02724912372457, Y: 159.17212443823877, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 188.8355401595914, Y: 142.1815547387638, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 187.3628384815965, Y: 124.74363535254275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 188.645658076118, Y: 107.29071993303108, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 192.65219287007278, Y: 90.25553394351101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 199.2831053268261, Y: 74.06044571455755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 208.37398940899908, Y: 59.10699429499533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 219.6994468417738, Y: 45.765933741533956, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.978675610319, Y: 34.36804068775615, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.88243213081068, Y: 25.195913108474826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.0411944758259, Y: 18.47696361989898, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 281.0543242560904, Y: 14.377781038872286, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 298.5, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 315.9456757439097, Y: 14.377781038872286, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.9588055241741, Y: 18.47696361989898, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.1175678691893, Y: 25.195913108474826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 364.021324389681, Y: 34.36804068775615, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 377.3005531582262, Y: 45.765933741533956, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 388.6260105910009, Y: 59.10699429499533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 397.7168946731739, Y: 74.0604457145576, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.3478071299272, Y: 90.25553394351101, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 408.35434192388203, Y: 107.2907199330312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 409.6371615184035, Y: 124.74363535254275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 408.1644598404086, Y: 142.1815547387638, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 403.9727508762754, Y: 159.1721244382388, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 397.16596334850374, Y: 175.29408233126424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.9128639196034, Y: 190.14770255367466, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 376.44287281197967, Y: 203.36470625132674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 363.04037559082815, Y: 214.61739264123992, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 348.0376721430016, Y: 223.6267639849736, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 331.8067376740114, Y: 230.1694430246376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 314.75, Y: 234.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 314.75, Y: 254.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 314.75, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.75, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 367.25, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 384.75, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 419.75, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 454.75, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 489.75, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 507.25, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 507.25, Y: 254.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 507.25, Y: 234.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 496.79792334355557, Y: 220.0473898423866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 496.65087972320316, Y: 202.5480021216062, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 506.86561713592346, Y: 188.3385217645467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 523.5, Y: 182.90276062558902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 540.1343828640765, Y: 188.3385217645467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 550.3491202767968, Y: 202.5480021216062, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 550.2020766564444, Y: 220.0473898423866, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 539.75, Y: 234.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 539.75, Y: 254.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 539.75, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 557.25, Y: 274.08321137147055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 294.0832113714705, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 294.0832113714705, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 263.5, Y: 254.08321137147055, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 189.24683133547322, Y: 202.02634276270095, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 217.43777628660538, Y: 18.213329513053907, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 401.0946497474127, Y: 47.40418506327211, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 370.9047481328149, Y: 230.89947943796057, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 398.5, Y: 294.08321137147055, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 473.8386347713222, Y: 196.49566229353246, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '89', X: 553.5, Y: 294.08321137147055, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'IDS, -1.4 ± 0.5
 kcal/mol, AUC: 0.61', X: 219.5, Y: 306.88321137147057, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 571.5, 306.88321137147057)
Updated viewBox: -0.25 0.0 576.75 311.88321137147057
Updated SVG: /disk1/www/rails/humanrnamap/public/result/99133984-2538-4c32-aecd-e47fe11d48ae/final_image/IDS_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/99133984-2538-4c32-aecd-e47fe11d48ae/final_image/IDS_fold_final_1.svg
