Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  7% [====                                              ] -                     
 15% [========                                          ] \                     
 23% [============                                      ] |                     
 31% [================                                  ] /                     
 39% [====================                              ] -                     
 46% [========================                          ] \                     
 54% [============================                      ] |                     
 62% [================================                  ] /                     
 70% [====================================              ] -                     
 78% [========================================          ] \                     
 85% [===========================================       ] |                     
 93% [===============================================   ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/9ac5d7d7-6c40-4a99-88fe-8bbfb881a9ff/final_image/TNRC18_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.32 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.32 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.32 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.92 MB
Based on canonical annotations, the following gene is in your area of interest: TNRC18(-)
write fasta - Elapsed time since the previous call: 0.41 seconds
write fasta - Current memory usage: 172.92 MB
Length of region: 64 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.32 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/9ac5d7d7-6c40-4a99-88fe-8bbfb881a9ff/fasta/TNRC18.fasta" "/disk1/www/rails/humanrnamap/public/result/9ac5d7d7-6c40-4a99-88fe-8bbfb881a9ff/ct/TNRC18.ct" --SHAPE "TNRC18.dat"

fold - Elapsed time since the previous call: 0.07 seconds
fold - Current memory usage: 176.32 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/9ac5d7d7-6c40-4a99-88fe-8bbfb881a9ff/ct/TNRC18.ct" "/disk1/www/rails/humanrnamap/public/result/9ac5d7d7-6c40-4a99-88fe-8bbfb881a9ff/fold_FE/TNRC18.txt" -sh "TNRC18.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.32 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/9ac5d7d7-6c40-4a99-88fe-8bbfb881a9ff/ct/TNRC18.ct" 1 "/disk1/www/rails/humanrnamap/public/result/9ac5d7d7-6c40-4a99-88fe-8bbfb881a9ff/fold_dbn/TNRC18_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.32 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CGCCACCCCCAGCUCCCACCCCACCAGCCCGCCGCCCGCCUCCCCACCGCCCACCCCGGGUAUC', '-structureDBN', '.((........)).............(((((......((.........))......)))))...', '-o', '/disk1/www/rails/humanrnamap/public/result/9ac5d7d7-6c40-4a99-88fe-8bbfb881a9ff/final_image/TNRC18_fold_1.svg', '-title', 'TNRC18, -7.1 ± 0.6\n kcal/mol, AUC: 0.53', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,34,38,41,59,12,14,49,63,58,27,60,61,31', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '5,7,39,40,42,15,16,53,55,57,26,29', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '4,6,11,13,18,20,21,25,28,35,36,43,44,45,51,52,54', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,3,8,9,10,17,19,22,23,24,30,32,33,37,46,47,48,50,56,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 249.97105659162494, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 10.59493192571631, Y: 236.9169424034448, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 7.911789309451706, Y: 219.62384393165502, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 15.063245393295375, Y: 203.65176877107905, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 29.74999272779968, Y: 194.13599440497183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 47.25000727220032, Y: 194.13599440497183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 61.93675460670465, Y: 203.65176877107905, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 69.0882106905483, Y: 219.62384393165505, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 66.40506807428369, Y: 236.9169424034448, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 54.75, Y: 249.97105659162494, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.75, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 72.25, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 89.75, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.25, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 212.25, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 269.9710565916249, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 269.971056591625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 269.971056591625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 269.971056591625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 299.75, Y: 269.971056591625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 249.97105659162497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 229.97105659162497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 209.97105659162497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 299.75, Y: 189.97105659162497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.4743323764884, Y: 181.43268212757644, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 273.1017374670141, Y: 168.13178197543198, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.0402128882831, Y: 151.7150898721562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.0402128882831, Y: 134.2150938769476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 273.1017374670141, Y: 117.79840177367186, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.47433237648835, Y: 104.49750162152742, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 299.75, Y: 95.95912715747886, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 75.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 287.17225050021045, Y: 63.79155987339237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 282.425391537516, Y: 46.94766465641493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 286.79887974925015, Y: 30.00298770599619, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.10468249167087, Y: 17.560451993495406, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 316.0, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.89531750832913, Y: 17.560451993495406, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 345.20112025074985, Y: 30.002987705996247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.574608462484, Y: 46.94766465641493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 344.82774949978955, Y: 63.79155987339237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 75.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 95.9591271574788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 347.5256676235116, Y: 104.49750162152736, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 358.8982625329859, Y: 117.7984017736718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 364.9597871117169, Y: 134.2150938769476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 364.9597871117169, Y: 151.71508987215617, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 358.89826253298594, Y: 168.13178197543195, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 347.52566762351165, Y: 181.4326821275764, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 189.97105659162497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 209.97105659162497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 229.97105659162497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 249.97105659162497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 332.25, Y: 269.971056591625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 269.971056591625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 367.25, Y: 269.971056591625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 384.75, Y: 269.971056591625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 289.9710565916249, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 85.16018660684117, Y: 216.96127547734153, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 173.5, Y: 289.9710565916249, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 276.0, Y: 209.97105659162497, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 266.2509469797163, Y: 74.04564858995141, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 346.5768696889856, Y: 87.40186227625458, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 348.5, Y: 249.97105659162497, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '64', X: 381.0, Y: 289.971056591625, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TNRC18, -7.1 ± 0.6
 kcal/mol, AUC: 0.53', X: 133.25, Y: 302.771056591625, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 5.0, 399.0, 302.771056591625)
Updated viewBox: -0.25 0.0 404.25 307.771056591625
Updated SVG: /disk1/www/rails/humanrnamap/public/result/9ac5d7d7-6c40-4a99-88fe-8bbfb881a9ff/final_image/TNRC18_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/9ac5d7d7-6c40-4a99-88fe-8bbfb881a9ff/final_image/TNRC18_fold_final_1.svg
