Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 66% [==================================                ] |                     
 72% [=====================================             ] /                     
 78% [========================================          ] -                     
 84% [===========================================       ] \                     
 90% [==============================================    ] |                     
 96% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/9c240224-a2b5-4f63-9e8e-87a9364d906c/final_image/BRCA1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.35 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.35 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.35 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.95 MB
Based on canonical annotations, the following gene is in your area of interest: BRCA1(-)
write fasta - Elapsed time since the previous call: 0.59 seconds
write fasta - Current memory usage: 172.95 MB
Length of region: 83 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.77 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/9c240224-a2b5-4f63-9e8e-87a9364d906c/fasta/BRCA1.fasta" "/disk1/www/rails/humanrnamap/public/result/9c240224-a2b5-4f63-9e8e-87a9364d906c/ct/BRCA1.ct" --SHAPE "BRCA1.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.77 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/9c240224-a2b5-4f63-9e8e-87a9364d906c/ct/BRCA1.ct" "/disk1/www/rails/humanrnamap/public/result/9c240224-a2b5-4f63-9e8e-87a9364d906c/fold_FE/BRCA1.txt" -sh "BRCA1.dat"

efn2 - Elapsed time since the previous call: 0.51 seconds
efn2 - Current memory usage: 176.77 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/9c240224-a2b5-4f63-9e8e-87a9364d906c/ct/BRCA1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/9c240224-a2b5-4f63-9e8e-87a9364d906c/fold_dbn/BRCA1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.77 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAGCCAAAUGAACAGACAAGUAAAAGACAUGACAGCGAUACUUUCCCAGAGCUGAAGUUAACAAAUGCACCUGGUUCUUUUAC', '-structureDBN', '...................((((((((.........((.....))((((.((..............))..)))).))))))))', '-o', '/disk1/www/rails/humanrnamap/public/result/9c240224-a2b5-4f63-9e8e-87a9364d906c/final_image/BRCA1_fold_1.svg', '-title', 'BRCA1, -6.0 ± 1.0\n kcal/mol, AUC: 0.693', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,9,10,15,20,21,26,30,31,35,37,39,42,43,44,49,51,53,54,57,58,59,66,67,72,73,74,75,76,78,79,80,81', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '36,6,71,12,77,62', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '65,68,69,70,82,83,22,24,25,29,40,45,46,48,60,61,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,2,4,5,7,8,11,13,14,16,17,18,19,23,27,28,32,33,34,38,41,47,50,52,55,56']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.25, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 301.0591716538203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 249.75, Y: 301.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.25, Y: 301.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 284.75, Y: 301.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 301.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 301.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 337.25, Y: 301.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 337.25, Y: 281.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 261.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 241.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 221.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 201.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 337.25, Y: 181.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 161.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 322.0935480635407, Y: 153.13996880839358, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.3128334190638, Y: 140.7445433830755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 303.17411173378116, Y: 125.20522352314305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 301.4446918733631, Y: 108.19226034926868, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 305.31046134678775, Y: 91.53430022842696, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 314.35590609980756, Y: 77.02183185708219, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 327.6087722389514, Y: 66.21473473957889, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 343.64456919960327, Y: 60.27461480426069, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 360.73968178587114, Y: 59.83994864265952, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 377.05663376246247, Y: 64.9574565520648, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 391.19876938619336, Y: 50.81532092833385, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 397.94447664615524, Y: 34.667682048281904, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 414.1244837476967, Y: 27.999985442126444, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 430.2883538007914, Y: 34.706706902298606, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 436.99507526096346, Y: 50.8705769553934, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 430.32737865480806, Y: 67.05058405693484, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 414.1797397747562, Y: 73.79629131689666, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 400.0376041510252, Y: 87.93842694062755, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 405.58437594527425, Y: 108.68768172481754, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 424.89683855194886, Y: 113.8866035424441, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 444.20930115862353, Y: 119.08552536007068, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 463.5217637652982, Y: 124.28444717769725, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 481.53130007946345, Y: 119.84469918363305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 497.7676297754515, Y: 128.81333110300676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 517.7676297754515, Y: 128.81333110300676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 526.7162373379518, Y: 113.77430587913074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 540.5204444174495, Y: 103.01820417366332, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 557.2906950840064, Y: 98.01734928945967, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 574.7314336123967, Y: 99.45627130831218, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 590.4553261471491, Y: 107.13800682495008, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 602.3100451978362, Y: 120.01105981253971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 608.6728858491396, Y: 136.31333314597822, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 608.6728858491396, Y: 153.8133290600353, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 602.3100451978362, Y: 170.1156023934737, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 590.455326147149, Y: 182.98865538106338, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 574.7314336123967, Y: 190.67039089770128, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 557.2906950840064, Y: 192.10931291655382, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 540.5204444174495, Y: 187.10845803235014, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 526.7162373379518, Y: 176.35235632688267, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 517.7676297754515, Y: 161.31333110300676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 497.7676297754515, Y: 161.31333110300676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 483.3736894726538, Y: 169.96907367721394, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 466.7226110588392, Y: 167.76703266750388, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 455.0735158116551, Y: 155.66719891354347, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 435.76105320498044, Y: 150.46827709591702, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 416.44859059830577, Y: 145.26935527829045, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 397.1361279916311, Y: 140.07043346066388, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 385.22883332542693, Y: 152.89487628412354, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 369.75, Y: 161.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 181.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 369.75, Y: 201.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 369.75, Y: 221.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 369.75, Y: 241.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 369.75, Y: 261.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 281.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.75, Y: 301.05917165382033, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 321.0591716538203, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 321.0591716538203, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 319.35786437626905, Y: 315.2013072775513, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 280.1273683226424, Y: 130.46218973234326, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 410.39861494595976, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 480.40339350519287, Y: 100.01732855445616, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 624.5777004944069, Y: 157.51309408773398, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 453.9518300144998, Y: 185.6171169628255, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 386.0, Y: 241.05917165382033, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '83', X: 366.0, Y: 321.05917165382033, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'BRCA1, -6.0 ± 1.0
 kcal/mol, AUC: 0.693', X: 240.71144292456978, Y: 333.85917165382034, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 642.5777004944069, 333.85917165382034)
Updated viewBox: -0.25 -5.0 647.8277004944069 343.85917165382034
Updated SVG: /disk1/www/rails/humanrnamap/public/result/9c240224-a2b5-4f63-9e8e-87a9364d906c/final_image/BRCA1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/9c240224-a2b5-4f63-9e8e-87a9364d906c/final_image/BRCA1_fold_final_1.svg
