Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/a267ff43-6e30-4233-9284-3a3f37c28a66/final_image/NFKB1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.95 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.95 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.95 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.56 MB
Based on canonical annotations, the following gene is in your area of interest: NFKB1(+)
write fasta - Elapsed time since the previous call: 0.33 seconds
write fasta - Current memory usage: 172.56 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.77 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/a267ff43-6e30-4233-9284-3a3f37c28a66/fasta/NFKB1.fasta" "/disk1/www/rails/humanrnamap/public/result/a267ff43-6e30-4233-9284-3a3f37c28a66/ct/NFKB1.ct" --SHAPE "NFKB1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 175.77 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/a267ff43-6e30-4233-9284-3a3f37c28a66/ct/NFKB1.ct" "/disk1/www/rails/humanrnamap/public/result/a267ff43-6e30-4233-9284-3a3f37c28a66/fold_FE/NFKB1.txt" -sh "NFKB1.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 175.77 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/a267ff43-6e30-4233-9284-3a3f37c28a66/ct/NFKB1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/a267ff43-6e30-4233-9284-3a3f37c28a66/fold_dbn/NFKB1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.77 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AACUCUGUUUUGCACCUAGCUGCCAAAGAAGGACAUGAUAAAGUUCUCAGUAUCUUACUCAAGCACAAAAAGGCAGCACUACUUC', '-structureDBN', '..................((((((.....(((((........))))).((((...))))............))))))........', '-o', '/disk1/www/rails/humanrnamap/public/result/a267ff43-6e30-4233-9284-3a3f37c28a66/final_image/NFKB1_fold_1.svg', '-title', 'NFKB1, -14.8 ± 0.5\n kcal/mol, AUC: 0.734', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,6,7,8,9,10,11,12,17,19,21,22,28,31,32,36,37,39,43,44,45,47,50,51,53,55,56,59,63,72,73,76,80,83,84', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '33,67,20,25,46,57', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,66,68,5,70,74,75,13,77,16,81,18,85,23,24,29,30,38,40,42,48,52,60,61,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,65,3,69,71,14,15,78,79,82,26,27,34,35,41,49,54,58']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 109.75, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 333.17899960631553, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 249.75, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.25, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.75, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.25, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 319.75, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 313.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.75, Y: 293.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 319.75, Y: 273.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 253.17899960631559, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 233.17899960631559, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 303.24415686678225, Y: 227.36497828893783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 288.55690909883225, Y: 217.8502289795677, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 276.50368863635987, Y: 205.16300793237417, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.7536869509586, Y: 190.00770615633593, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 262.7927017198989, Y: 173.2257418209395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 261.89616547323885, Y: 155.74884495176565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 242.71657224670764, Y: 150.07934729634707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 223.53697902017637, Y: 144.40984964092848, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 204.35738579364514, Y: 138.7403519855098, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 185.1777925671139, Y: 133.0708543300912, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 169.35524350796987, Y: 140.54731407553317, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 152.01091025360276, Y: 138.21823421093262, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 138.72127320044024, Y: 126.83245114390371, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 133.75916310050562, Y: 110.05067613616512, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 138.71997767196916, Y: 93.26851811516593, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 152.00873572977355, Y: 81.88170915324105, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 169.35288913295415, Y: 79.5512903537176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 185.17601531011468, Y: 87.02652861319064, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.39072625716915, Y: 101.90401533697792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 213.5703194837004, Y: 107.57351299239656, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.74991271023163, Y: 113.2430106478152, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 251.9295059367629, Y: 118.91250830323378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 271.1090991632941, Y: 124.58200595865242, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 281.3637030796662, Y: 110.40127612841007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 294.6517416911653, Y: 99.0136499552645, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 287.42196401149397, Y: 80.36612157473832, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 280.19218633182265, Y: 61.71859319421219, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 272.96240865215134, Y: 43.07106481368601, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 267.5221029113463, Y: 26.4381496951936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 278.73222889912967, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 296.07109378823645, Y: 15.369505486321941, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 303.2646422705062, Y: 31.32267608422012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.49441995017753, Y: 49.9702044647463, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.72419762984885, Y: 68.61773284527237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 324.95397530952016, Y: 87.26526122579861, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 342.44546151234607, Y: 86.71944952168184, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 359.5790924489894, Y: 90.2815684033165, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 375.40360030910614, Y: 97.75384723812346, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 389.0404004542428, Y: 108.72142134553661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 399.732370879021, Y: 122.57536549280627, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 406.8858880058202, Y: 138.54650173030018, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 410.10378496448703, Y: 155.74810453827723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 409.2074024967998, Y: 173.22513227389697, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.24650820837707, Y: 190.00725156375705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 395.49653344617303, Y: 205.16271070100498, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 383.44328121151216, Y: 217.85007096891115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 368.7559541330252, Y: 227.36492374178914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 233.17899960631559, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 253.17899960631559, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 273.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 293.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 313.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 387.25, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 404.75, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 422.25, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 439.75, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 457.25, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 474.75, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 492.25, Y: 333.1789996063156, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 353.17899960631553, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 353.17899960631553, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 296.0, Y: 313.1789996063156, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 243.19423772921732, Y: 169.03191149295102, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 140.0849452866303, Y: 63.62823962573532, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 265.0244356309679, Y: 87.59589925440969, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 340.43115351744046, Y: 66.79490753790083, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 392.46923584820263, Y: 233.2375653432798, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 401.0, Y: 353.1789996063156, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 488.5, Y: 353.1789996063156, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'NFKB1, -14.8 ± 0.5
 kcal/mol, AUC: 0.734', X: 182.5, Y: 365.9789996063156, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 506.5, 365.9789996063156)
Updated viewBox: -0.25 0.0 511.75 370.9789996063156
Updated SVG: /disk1/www/rails/humanrnamap/public/result/a267ff43-6e30-4233-9284-3a3f37c28a66/final_image/NFKB1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/a267ff43-6e30-4233-9284-3a3f37c28a66/final_image/NFKB1_fold_final_1.svg
