Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 46% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 63% [================================                  ] |                     
 69% [===================================               ] /                     
 75% [======================================            ] -                     
 81% [=========================================         ] \                     
 87% [============================================      ] |                     
 93% [===============================================   ] /                     
 98% [==================================================] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/a382d8b1-47f4-44ad-b2f8-77f00f995bee/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.88 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.88 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.88 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.43 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.36 seconds
write fasta - Current memory usage: 172.43 MB
Length of region: 86 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 176.12 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/a382d8b1-47f4-44ad-b2f8-77f00f995bee/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/a382d8b1-47f4-44ad-b2f8-77f00f995bee/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 176.12 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/a382d8b1-47f4-44ad-b2f8-77f00f995bee/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/a382d8b1-47f4-44ad-b2f8-77f00f995bee/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.54 seconds
efn2 - Current memory usage: 176.12 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/a382d8b1-47f4-44ad-b2f8-77f00f995bee/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/a382d8b1-47f4-44ad-b2f8-77f00f995bee/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.12 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACUGUAUAACACUAUGGUGAUUUCUCAGCCUGCAGCCGGAAGCAUGGUCCAGAUUCCAUCUAGUAUGCCACAAAACAGCACCCAGA', '-structureDBN', '..........((((.((((...(((..((((((........))).)))..)))...)))))))).(((.........)))......', '-o', '/disk1/www/rails/humanrnamap/public/result/a382d8b1-47f4-44ad-b2f8-77f00f995bee/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -15.8 ± 0.8\n kcal/mol, AUC: 0.694', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,5,7,13,15,16,17,18,19,21,22,23,25,28,31,32,35,38,39,42,45,46,47,48,52,54,55,59,61,63,64,66,67,78,85', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '36,76,77,14,79,80,81,82,57,30', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '33,34,68,37,69,73,43,44,49,58,60,29', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,65,6,70,8,9,10,11,12,71,72,74,75,83,20,84,86,24,26,27,40,41,50,51,53,56,62']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 417.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 397.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 377.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 175.93438113341733, Y: 360.4804823697018, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 186.65572209255677, Y: 346.6491730366994, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 195.16734010780456, Y: 328.5507654061229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 203.67895812305235, Y: 310.4523577755464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.19057613830014, Y: 292.3539501449699, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 206.07824387059097, Y: 275.9560939723175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 209.11025717336938, Y: 258.720746916292, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 220.45180634138492, Y: 245.3933482474085, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 236.9802021340074, Y: 239.64335474025629, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 245.49182955870015, Y: 221.54495153491197, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 254.00345698339294, Y: 203.44654832956758, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 250.60687560785135, Y: 186.27932719071293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 258.0545557472022, Y: 170.4432194867053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 273.443549157297, Y: 162.11080516100878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 281.95518376680263, Y: 144.01240533466319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 290.46681837630825, Y: 125.91400550831759, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 294.2824569787972, Y: 108.8350621866532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 294.2824569787972, Y: 88.8350621866532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 294.2824569787972, Y: 68.8350621866532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.6273889045135, Y: 55.78094799847304, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 279.9442462882489, Y: 38.48784952668325, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 287.09570237209255, Y: 22.51577436610728, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 301.7824497065969, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 319.2824642509975, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 333.96921158550185, Y: 22.51577436610728, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 341.1206676693455, Y: 38.48784952668325, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 338.4375250530809, Y: 55.78094799847304, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 326.7824569787972, Y: 68.8350621866532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 326.7824569787972, Y: 88.8350621866532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 326.7824569787972, Y: 108.8350621866532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 330.5980737902188, Y: 125.91410304707733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 319.8767180941198, Y: 139.74541174876424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 311.36508348461416, Y: 157.84381157510984, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.8534488751086, Y: 175.94221140145544, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 306.2500243393221, Y: 193.10942652551978, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 298.8023471993602, Y: 208.94552785188438, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 283.4133621920775, Y: 217.27794289469335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 274.9017347673847, Y: 235.3763461000377, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 266.390107342692, Y: 253.474749305382, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 272.50243029437183, Y: 269.8726000223012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 269.4704162008843, Y: 287.1079384447661, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 258.1288741870144, Y: 300.435332216529, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 241.60048853798696, Y: 306.1853294197475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 233.08887052273914, Y: 324.283737050324, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 224.57725250749135, Y: 342.3821446809005, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 216.06563449224356, Y: 360.480552311477, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 377.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 397.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 417.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 212.25, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 247.25, Y: 437.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 417.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 397.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 234.67225050021045, Y: 385.39194674705027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.92539153751602, Y: 368.5480515300728, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 234.29887974925018, Y: 351.6033745796541, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 246.60468249167093, Y: 339.1608388671533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.5, Y: 334.60038687365795, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 280.3953175083291, Y: 339.1608388671533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 292.70112025074985, Y: 351.6033745796542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 297.074608462484, Y: 368.5480515300728, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 292.32774949978955, Y: 385.39194674705027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 279.75, Y: 397.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 279.75, Y: 417.5595140311367, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.75, Y: 437.55951403113676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 297.25, Y: 437.55951403113676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 314.75, Y: 437.55951403113676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 437.55951403113676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.75, Y: 437.55951403113676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 367.25, Y: 437.55951403113676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.75, Y: 437.55951403113676, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 457.5595140311367, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 457.5595140311367, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 182.41159917458828, Y: 277.78017293255687, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 268.6184185499627, Y: 117.40237089881191, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 357.1926435856384, Y: 35.82528107236976, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 309.5893547698289, Y: 222.68144467225488, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 231.83446308598846, Y: 356.1198952132857, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 206.17661249667293, Y: 368.7690421985088, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 290.14213562373095, Y: 451.7016496548677, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '86', X: 381.0, Y: 457.55951403113676, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -15.8 ± 0.8
 kcal/mol, AUC: 0.694', X: 128.75, Y: 470.35951403113677, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 399.0, 470.35951403113677)
Updated viewBox: -0.25 0.0 404.25 475.35951403113677
Updated SVG: /disk1/www/rails/humanrnamap/public/result/a382d8b1-47f4-44ad-b2f8-77f00f995bee/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/a382d8b1-47f4-44ad-b2f8-77f00f995bee/final_image/CLOCK_fold_final_1.svg
