Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 20% [===========                                       ] /                     
 26% [==============                                    ] -                     
 31% [================                                  ] \                     
 36% [===================                               ] |                     
 41% [=====================                             ] /                     
 46% [========================                          ] -                     
 52% [===========================                       ] \                     
 57% [=============================                     ] |                     
 62% [================================                  ] /                     
 67% [==================================                ] -                     
 72% [=====================================             ] \                     
 78% [========================================          ] |                     
 83% [==========================================        ] /                     
 88% [=============================================     ] -                     
 93% [===============================================   ] \                     
 98% [==================================================] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/a45a9cdb-cda3-4812-9645-0edeaab31921/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.80 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.80 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.80 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.33 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.33 seconds
write fasta - Current memory usage: 172.33 MB
Length of region: 96 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.10 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/a45a9cdb-cda3-4812-9645-0edeaab31921/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/a45a9cdb-cda3-4812-9645-0edeaab31921/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.12 seconds
fold - Current memory usage: 176.10 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/a45a9cdb-cda3-4812-9645-0edeaab31921/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/a45a9cdb-cda3-4812-9645-0edeaab31921/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 176.10 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/a45a9cdb-cda3-4812-9645-0edeaab31921/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/a45a9cdb-cda3-4812-9645-0edeaab31921/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.10 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAUUGCAAAGGAAUAGAAUCGACUAUUUUUAUAGUAUAUUUAAUAUAUUUGUAUAUAACUAUAAUAGGAACCCUCUACAUGCCUCCCACUUUUCUA', '-structureDBN', '........(((.((((......))))..(((((((((((.(((.....))).))))).)))))).(((...))).......)))............', '-o', '/disk1/www/rails/humanrnamap/public/result/a45a9cdb-cda3-4812-9645-0edeaab31921/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -8.0 ± 1.0\n kcal/mol, AUC: 0.643', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,5,10,11,14,16,19,21,24,26,27,28,29,30,32,34,35,37,39,40,41,44,46,48,49,50,51,52,54,56,60,62,65,67,68,74,76,80,81,84,90,91,92,93,95', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '83,53,72,73,25,31', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,2,66,70,71,15,79,18,85,86,88,94,96,33,38,47,57,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,69,6,7,8,9,75,12,13,77,78,17,82,20,22,23,87,89,36,42,43,45,55,58,59,61']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.94608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 180.44608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.94608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 215.44608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 232.94608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 250.44608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 267.94608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 285.44608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.94608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.94608465924426, Y: 299.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 302.94608465924426, Y: 279.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 289.2076118873892, Y: 273.70626380363814, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.13040695947967, Y: 265.16740169811277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 260.35592845104753, Y: 276.0585389560004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 243.5814499426154, Y: 286.9496762138881, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 226.80697143418325, Y: 297.84081347177573, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 218.96067156208193, Y: 313.4832151459476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 202.88053311474022, Y: 320.38816259928825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 186.1348329064635, Y: 315.30577375607754, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 176.6051010024708, Y: 300.62812538663167, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 178.77660034074736, Y: 283.26339842526147, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 191.62729319767686, Y: 271.3844740246293, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 209.10887339011583, Y: 270.5822858955735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 225.88335189854797, Y: 259.69114863768584, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 242.6578304069801, Y: 248.8000113797982, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 259.43230891541225, Y: 237.90887412191057, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 256.39207332663545, Y: 220.6749840339259, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 258.2221740244608, Y: 203.27094049698258, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.7806900448029, Y: 187.0463952765175, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 250.63855442107194, Y: 172.90425965278655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 236.496418797341, Y: 158.7621240290556, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 222.35428317361, Y: 144.61998840532465, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.21214754987906, Y: 130.4778527815937, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.0700119261481, Y: 116.33571715786275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.2952244401818, Y: 106.95700752349796, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 160.47914211657843, Y: 100.17799240392651, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 141.663059792975, Y: 93.398977284355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 122.84697746937155, Y: 86.61996216478349, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 104.03089514576811, Y: 79.84094704521203, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 86.54928070690835, Y: 80.64129507593043, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.59490700107887, Y: 68.8755990808379, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 54.77880091915, Y: 62.096649906105654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 35.96269483722125, Y: 55.31770073137352, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 18.479520467576265, Y: 56.085438836625144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 5.559924833914749, Y: 44.281420177696305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 4.75, Y: 26.80014935429574, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 16.52280778098094, Y: 13.85210684626611, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 34.00207326212205, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 46.97848724616102, Y: 24.74152834823917, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 65.79459332808983, Y: 31.520477522971305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 84.61069941001864, Y: 38.29942669770355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 102.09238664424322, Y: 37.49904463596704, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 115.04679471507183, Y: 49.26481326935652, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 133.8628770386752, Y: 56.04382838892798, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 152.67895936227865, Y: 62.82284350849943, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 171.4950416858821, Y: 69.60185862807089, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 190.3111240094855, Y: 76.3808737476424, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 207.6723936911088, Y: 78.58003609770839, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 217.0509823147109, Y: 93.35474676929994, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 231.19311793844184, Y: 107.49688239303089, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 245.3352535621728, Y: 121.63901801676184, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 259.47738918590375, Y: 135.7811536404928, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 273.6195248096347, Y: 149.92328926422374, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 287.76166043336565, Y: 164.0654248879547, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 306.65037586539944, Y: 156.90352345654878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 326.83547079377314, Y: 156.10455817690905, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.31738478372085, Y: 137.55675606865304, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 341.7992987736685, Y: 119.0089539603971, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 349.2084600409626, Y: 103.15477087807972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 366.5778544295057, Y: 101.02054257078487, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 377.6047720008871, Y: 114.60943070655117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 371.93947719958453, Y: 131.1670641940621, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 364.45756320963676, Y: 149.71486630231811, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 356.9756492196891, Y: 168.26266841057407, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.3590445403854, Y: 180.62800384198704, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 377.8523940094143, Y: 195.92875594104896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 381.7970538994708, Y: 212.97837934896557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 380.88712304607225, Y: 230.4547069335021, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 375.1931649237413, Y: 247.00248143345053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 365.1567355775325, Y: 261.33845318211684, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 351.5561417588074, Y: 272.35089377346884, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 335.44608465924426, Y: 279.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 335.44608465924426, Y: 299.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 335.44608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.94608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 370.44608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 387.94608465924426, Y: 319.18580856802294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 405.44608465924426, Y: 319.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 422.94608465924426, Y: 319.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 440.44608465924426, Y: 319.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 457.94608465924426, Y: 319.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 475.44608465924426, Y: 319.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 492.9460846592442, Y: 319.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 510.4460846592442, Y: 319.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 527.9460846592442, Y: 319.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 545.4460846592442, Y: 319.185808568023, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 163.69608465924426, Y: 339.18580856802294, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 279.19608465924426, Y: 299.18580856802294, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 153.36246836221136, Y: 305.1044266222381, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 232.74641879734105, Y: 187.04639527651753, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 76.02029855974608, Y: 99.45738927872543, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 68.82354250282197, Y: 12.704371441042497, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 241.5852535621728, Y: 93.35474676929994, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 370.3097684194534, Y: 82.47274046252892, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 376.0340265543807, Y: 274.9781877352016, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 436.69608465924426, Y: 339.185808568023, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '96', X: 541.6960846592442, Y: 339.185808568023, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -8.0 ± 1.0
 kcal/mol, AUC: 0.643', X: 209.0980423296221, Y: 351.985808568023, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 4.704371441042497, 559.6960846592442, 351.985808568023)
Updated viewBox: -0.25 -0.2956285589575032 564.9460846592442 357.2814371269805
Updated SVG: /disk1/www/rails/humanrnamap/public/result/a45a9cdb-cda3-4812-9645-0edeaab31921/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/a45a9cdb-cda3-4812-9645-0edeaab31921/final_image/CLOCK_fold_final_1.svg
