Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 26% [==============                                    ] -                     
 32% [=================                                 ] \                     
 37% [===================                               ] |                     
 43% [======================                            ] /                     
 48% [=========================                         ] -                     
 53% [===========================                       ] \                     
 59% [==============================                    ] |                     
 64% [=================================                 ] /                     
 69% [===================================               ] -                     
 75% [======================================            ] \                     
 80% [=========================================         ] |                     
 86% [============================================      ] /                     
 91% [==============================================    ] -                     
 96% [================================================= ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/b1a2d54e-c10c-45e9-b982-6103b0dafc6b/final_image/CLASP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 156.86 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 156.86 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 156.86 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.45 MB
Based on canonical annotations, the following gene is in your area of interest: CLASP1(-)
write fasta - Elapsed time since the previous call: 1.55 seconds
write fasta - Current memory usage: 170.45 MB
Length of region: 93 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 173.55 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/b1a2d54e-c10c-45e9-b982-6103b0dafc6b/fasta/CLASP1.fasta" "/disk1/www/rails/humanrnamap/public/result/b1a2d54e-c10c-45e9-b982-6103b0dafc6b/ct/CLASP1.ct" --SHAPE "CLASP1.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 173.55 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/b1a2d54e-c10c-45e9-b982-6103b0dafc6b/ct/CLASP1.ct" "/disk1/www/rails/humanrnamap/public/result/b1a2d54e-c10c-45e9-b982-6103b0dafc6b/fold_FE/CLASP1.txt" -sh "CLASP1.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 173.55 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/b1a2d54e-c10c-45e9-b982-6103b0dafc6b/ct/CLASP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/b1a2d54e-c10c-45e9-b982-6103b0dafc6b/fold_dbn/CLASP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.55 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGAUUUUGUAAACUCUAGUGAGACAAGGCUUGCUGUUUCUAGAAUCAUAACCUGGACAACAGAACCAAAGAGUUCAGACGUGAGAAAGGCAGC', '-structureDBN', '.....((((...(((....))))))).(((.(((.(((((.....(((...((((((..............))))))..))))))))))))))', '-o', '/disk1/www/rails/humanrnamap/public/result/b1a2d54e-c10c-45e9-b982-6103b0dafc6b/final_image/CLASP1_fold_1.svg', '-title', 'CLASP1, -15.7 ± 1.3\n kcal/mol, AUC: 0.622', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,4,5,6,7,8,9,14,16,18,19,20,22,27,28,30,31,32,34,35,36,37,38,40,42,45,48,53,54,55,62,70,72,73,74,77,80,81,82,84,88,89,92', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '33,67,75,76,78,83,52,93', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '66,39,12,44,15,79,17,85,87,56,91,60,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,65,3,68,69,71,10,11,13,21,86,23,24,25,26,90,29,41,43,46,47,49,50,51,57,58,59,61']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 239.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 22.25, Y: 239.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 239.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 57.25, Y: 239.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 239.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 239.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 219.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 199.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 179.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 83.45286268950835, Y: 164.00698371933274, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 86.5095795270139, Y: 146.7760466095536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 99.97352309500573, Y: 135.5970066192957, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 117.47272276333175, Y: 135.76047672027136, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 134.85516485272248, Y: 125.86852509235806, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 152.23760694211325, Y: 115.97657346444475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 165.37607434979182, Y: 104.41664587929284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 182.63576137095274, Y: 107.30705338138603, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 191.2912367321201, Y: 122.51672128929289, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 184.96088663503912, Y: 138.83168127223414, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 168.31202833747238, Y: 144.22304185970472, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 150.92958624808162, Y: 154.11499348761802, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 133.54714415869086, Y: 164.00694511553132, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 179.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 199.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 219.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 239.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 142.25, Y: 239.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 159.75, Y: 239.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 159.75, Y: 219.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 199.13507304502784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 155.93438113341733, Y: 182.05604138359283, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 166.65572209255677, Y: 168.22473205059046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 175.16734010780456, Y: 150.12632442001396, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 183.67895812305235, Y: 132.02791678943746, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 186.9219048899865, Y: 115.72467093444499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 201.1609262315514, Y: 107.14779502442053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 215.30306185528235, Y: 93.00565940068955, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.4451974790133, Y: 78.8635237769586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 243.58733310274425, Y: 64.72138815322762, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 257.7294687264752, Y: 50.57925252949667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 259.0425186221738, Y: 32.518287439456685, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 270.31414231251864, Y: 18.345318117698753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 287.6158802088353, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 304.9176181051519, Y: 18.345318117698753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 316.18924179549674, Y: 32.518287439456685, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 317.50229169119535, Y: 50.57925252949667, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 331.6444273149263, Y: 64.72138815322762, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 345.78656293865726, Y: 78.8635237769586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 363.25268389897985, Y: 79.95141535378164, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 377.28139820506175, Y: 90.41296707433801, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 383.3064850722905, Y: 106.84303760753687, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 379.36683272078545, Y: 123.89378623722536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 388.8872242505068, Y: 141.48247991017362, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 398.4076157802281, Y: 159.07117358312186, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 407.92800730994946, Y: 176.6598672560701, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 417.4483988396708, Y: 194.24856092901837, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 426.96879036939214, Y: 211.83725460196663, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 444.45434314155835, Y: 212.54810004494624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 460.48470484989406, Y: 219.56788355243, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 472.8655977028099, Y: 231.93571881801438, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 479.90229274025563, Y: 247.95866423831723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 480.6315887614233, Y: 265.44345718263094, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 474.95365782157546, Y: 281.9967335119361, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 463.6457099419311, Y: 295.3526375151574, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 448.2556065714213, Y: 303.6829781586748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 430.8899852676135, Y: 305.84747665134046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 413.92589764402675, Y: 301.54985078450557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 399.68543233498394, Y: 291.3783708148077, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 390.1178614366525, Y: 276.72533549452623, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 386.53281904984914, Y: 259.59649058084807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 389.42103514276783, Y: 242.3364771164089, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 398.3871631508512, Y: 227.3078908377638, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 388.8667716211299, Y: 209.71919716481557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 379.34638009140855, Y: 192.1305034918673, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 369.8259885616872, Y: 174.54180981891906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 360.3055970319659, Y: 156.95311614597082, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 350.78520550224454, Y: 139.36442247302256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.35508892346996, Y: 133.33936901202517, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 323.89349552449346, Y: 119.31064620649181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 322.80559255009445, Y: 101.84449416552144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 308.6634569263635, Y: 87.70235854179046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 294.52132130263254, Y: 73.56022291805951, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 280.710439115038, Y: 73.56022291805951, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 266.56830349130706, Y: 87.70235854179046, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 252.4261678675761, Y: 101.84449416552144, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 238.28403224384516, Y: 115.98662978925236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 224.14189662011418, Y: 130.1287654129833, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 213.08887052273914, Y: 145.85929606421516, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 204.57725250749135, Y: 163.95770369479163, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 196.06563449224356, Y: 182.0561113253681, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.25, Y: 199.13507304502784, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 192.25, Y: 219.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 192.25, Y: 239.1350730450278, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 259.1350730450278, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 60.01032440104211, Y: 167.50039691523313, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 176.46010622765937, Y: 160.29897861371828, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 136.12066062619363, Y: 196.94147644103884, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 237.23716310679214, Y: 39.63872226185754, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 389.56422426852845, Y: 78.45686033265062, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 485.62382464845774, Y: 220.64508362281893, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 362.78692373479345, Y: 260.00167023153875, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 302.20076486820193, Y: 112.61086699083774, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 211.8344630859885, Y: 177.69545422717687, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '93', X: 188.5, Y: 259.1350730450278, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLASP1, -15.7 ± 1.3
 kcal/mol, AUC: 0.622', X: 176.69079438071162, Y: 323.64747665134047, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 503.62382464845774, 323.64747665134047)
Updated viewBox: -0.25 0.0 508.87382464845774 328.64747665134047
Updated SVG: /disk1/www/rails/humanrnamap/public/result/b1a2d54e-c10c-45e9-b982-6103b0dafc6b/final_image/CLASP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/b1a2d54e-c10c-45e9-b982-6103b0dafc6b/final_image/CLASP1_fold_final_1.svg
