Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 40% [=====================                             ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 57% [=============================                     ] \                     
 63% [================================                  ] |                     
 68% [===================================               ] /                     
 74% [======================================            ] -                     
 80% [=========================================         ] \                     
 86% [============================================      ] |                     
 91% [==============================================    ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/b4081f5f-11e0-4f38-b35b-e617318a55e4/final_image/BCOR_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.72 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.72 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.72 MB
read annotations - Elapsed time since the previous call: 0.08 seconds
read annotations - Current memory usage: 172.32 MB
Based on canonical annotations, the following gene is in your area of interest: BCOR(-)
write fasta - Elapsed time since the previous call: 0.25 seconds
write fasta - Current memory usage: 172.32 MB
Length of region: 87 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.54 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/b4081f5f-11e0-4f38-b35b-e617318a55e4/fasta/BCOR.fasta" "/disk1/www/rails/humanrnamap/public/result/b4081f5f-11e0-4f38-b35b-e617318a55e4/ct/BCOR.ct" --SHAPE "BCOR.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 175.54 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/b4081f5f-11e0-4f38-b35b-e617318a55e4/ct/BCOR.ct" "/disk1/www/rails/humanrnamap/public/result/b4081f5f-11e0-4f38-b35b-e617318a55e4/fold_FE/BCOR.txt" -sh "BCOR.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 175.54 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/b4081f5f-11e0-4f38-b35b-e617318a55e4/ct/BCOR.ct" 1 "/disk1/www/rails/humanrnamap/public/result/b4081f5f-11e0-4f38-b35b-e617318a55e4/fold_dbn/BCOR_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 175.54 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAGAGUACCUGCUCGGGCCAGGUAAAUGCUAUUGGAUGUAAUCCAGUAGUGUGUAAUAUAAAUUCAAACCAUAUCCACACACAACAA', '-structureDBN', '.....(((((((....).))))))...((((((((((...))))))))))((((......................)))).......', '-o', '/disk1/www/rails/humanrnamap/public/result/b4081f5f-11e0-4f38-b35b-e617318a55e4/final_image/BCOR_fold_1.svg', '-title', 'BCOR, -30.1 ± 0.7\n kcal/mol, AUC: 0.844', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,5,6,10,11,13,15,16,17,21,22,23,27,28,30,32,33,34,35,37,38,39,42,46,47,49,50,51,52,53,54,57,59,63,64,72,74', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '65,66,67,68,69,70,71,8,9,75,77,78,79,80,20,29,31,43,44,45,48', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '36,7,41,12,76,19,56,26,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,4,73,14,81,18,82,83,84,85,86,24,25,87,40,55,58,61,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 74.75, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 198.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 178.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 158.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 138.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 118.9518258454265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 88.43439675932204, Y: 101.87272424227066, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 77.93022870266898, Y: 87.87580654464256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 82.15291788803466, Y: 70.89286958896895, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 97.98910884427181, Y: 63.445299005605534, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 113.76290273264922, Y: 71.02412991568497, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 117.84440558102114, Y: 88.04154999322077, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 128.5656344922436, Y: 101.87286412576682, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 124.75, Y: 118.9518258454265, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 138.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 158.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 124.75, Y: 178.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 124.75, Y: 198.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 159.75, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 198.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 178.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 158.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 138.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 118.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 78.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 58.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 38.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 195.69020113855714, Y: 21.477077958505106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 211.0, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 226.30979886144286, Y: 21.477077958505106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 38.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 58.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 78.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 227.25, Y: 98.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 118.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.25, Y: 138.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 158.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 227.25, Y: 178.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 227.25, Y: 198.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.25, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 198.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.75, Y: 178.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 244.75, Y: 158.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 228.38716804104297, Y: 152.74628599506087, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.0949618594506, Y: 142.64758127542507, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 202.78080987395873, Y: 129.2968899300028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 195.16306045675606, Y: 113.5418625302091, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 191.7253731786709, Y: 96.38280367694935, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.68601071316505, Y: 78.9091615242994, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.98398109106108, Y: 62.23035747765158, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 207.28291015000502, Y: 47.40534776742646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 219.99239831244515, Y: 35.375389114116956, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 235.3055057260136, Y: 26.90427726902493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 252.2499857921324, Y: 22.529852753680757, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 269.75001420786765, Y: 22.529852753680757, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 286.6944942739865, Y: 26.90427726902493, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 302.0076016875549, Y: 35.375389114116956, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 314.717089849995, Y: 47.40534776742646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 324.0160189089389, Y: 62.23035747765152, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 329.31398928683495, Y: 78.90916152429946, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 330.2746268213291, Y: 96.38280367694935, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 326.83693954324394, Y: 113.5418625302091, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.21919012604127, Y: 129.2968899300028, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 307.9050381405493, Y: 142.64758127542513, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 293.61283195895703, Y: 152.74628599506087, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.25, Y: 158.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 277.25, Y: 178.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.25, Y: 198.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 277.25, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 294.75, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 312.25, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 329.75, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 347.25, Y: 218.95182584542653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 364.75, Y: 218.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 382.25, Y: 218.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 399.75, Y: 218.95182584542655, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 238.95182584542653, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 68.5, Y: 138.95182584542653, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 141.0, Y: 138.95182584542653, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 171.0, Y: 178.95182584542653, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 239.51092021861837, Y: 10.862960720867846, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 223.5, Y: 238.95182584542653, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 169.26360643283988, Y: 75.30409428062089, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 338.41276473735394, Y: 53.82228898132601, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 287.64213562373095, Y: 233.09396146915748, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '87', X: 396.0, Y: 238.95182584542655, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'BCOR, -30.1 ± 0.7
 kcal/mol, AUC: 0.844', X: 136.25, Y: 251.75182584542657, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 2.8629607208678465, 414.0, 251.75182584542657)
Updated viewBox: -0.25 -2.1370392791321535 419.25 258.8888651245587
Updated SVG: /disk1/www/rails/humanrnamap/public/result/b4081f5f-11e0-4f38-b35b-e617318a55e4/final_image/BCOR_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/b4081f5f-11e0-4f38-b35b-e617318a55e4/final_image/BCOR_fold_final_1.svg
