Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 36% [===================                               ] \                     
 42% [======================                            ] |                     
 48% [=========================                         ] /                     
 54% [============================                      ] -                     
 60% [===============================                   ] \                     
 66% [==================================                ] |                     
 72% [=====================================             ] /                     
 78% [========================================          ] -                     
 84% [===========================================       ] \                     
 90% [==============================================    ] |                     
 96% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/b59e1b5f-78c8-45a3-8ee4-1f15c49b41cd/final_image/TEX2_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.20 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.20 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.20 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 171.84 MB
Based on canonical annotations, the following gene is in your area of interest: TEX2(-)
write fasta - Elapsed time since the previous call: 0.63 seconds
write fasta - Current memory usage: 171.84 MB
Length of region: 83 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 175.24 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/b59e1b5f-78c8-45a3-8ee4-1f15c49b41cd/fasta/TEX2.fasta" "/disk1/www/rails/humanrnamap/public/result/b59e1b5f-78c8-45a3-8ee4-1f15c49b41cd/ct/TEX2.ct" --SHAPE "TEX2.dat"

fold - Elapsed time since the previous call: 0.13 seconds
fold - Current memory usage: 175.24 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/b59e1b5f-78c8-45a3-8ee4-1f15c49b41cd/ct/TEX2.ct" "/disk1/www/rails/humanrnamap/public/result/b59e1b5f-78c8-45a3-8ee4-1f15c49b41cd/fold_FE/TEX2.txt" -sh "TEX2.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 175.24 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/b59e1b5f-78c8-45a3-8ee4-1f15c49b41cd/ct/TEX2.ct" 1 "/disk1/www/rails/humanrnamap/public/result/b59e1b5f-78c8-45a3-8ee4-1f15c49b41cd/fold_dbn/TEX2_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 175.24 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CACACACAACACGCUAUCAGCUUGGGUAAGGACAGUGGGAUUUAUGUGAACAUCAGGCAAAGCCAUGAGAUCAAACCAUCCCA', '-structureDBN', '.........((.(((...))).))...........((((((.....(((...((((((...))).)))..)))....))))))', '-o', '/disk1/www/rails/humanrnamap/public/result/b59e1b5f-78c8-45a3-8ee4-1f15c49b41cd/final_image/TEX2_fold_1.svg', '-title', 'TEX2, -18.7 ± 0.7\n kcal/mol, AUC: 0.702', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '13,15,17,20,22,23,24,25,26,27,30,31,35,36,37,38,39,41,42,43,45,46,47,48,53,56,57,62,66,67,69,71,79', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '32,64,78,80,81,82,51,52,21,54', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,2,34,5,6,40,9,10,72,73,77,14,83,58,28', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '65,3,4,68,70,7,8,74,11,12,75,76,16,18,19,29,33,44,49,50,55,59,60,61,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 162.25, Y: 395.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 155.57162284851074, Y: 379.3384798956696, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.25, Y: 363.16294346558686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 343.16294346558686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 323.16294346558686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 163.19020113855714, Y: 305.6881955786654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.5, Y: 297.2111176201603, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 193.80979886144286, Y: 305.6881955786654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 323.16294346558686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 343.16294346558686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 363.16294346558686, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 201.42837715148926, Y: 379.3384798956696, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.75, Y: 395.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.25, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 229.75, Y: 415.5140163257523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 247.25, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.75, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 299.75, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.25, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 387.25, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 404.75, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 404.75, Y: 395.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 404.75, Y: 375.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 404.75, Y: 355.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 335.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 404.75, Y: 315.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 390.45440617077446, Y: 305.4202186418443, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 381.59078592680186, Y: 290.3309843741786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 379.73537154905046, Y: 272.9296570655883, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 385.2181144519859, Y: 256.3107435970678, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 397.0640093765851, Y: 243.42961289944606, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 413.166481191788, Y: 236.57693779738173, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 417.3834474218809, Y: 217.02656194896758, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 421.6004136519737, Y: 197.47618610055338, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 413.0458748498185, Y: 182.20959658730703, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 414.23152517990815, Y: 164.7498393502118, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 424.771446085316, Y: 150.77990889973034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 441.23498776760823, Y: 144.8468924022843, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 450.8536353122725, Y: 127.31173858455224, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 460.4722828569368, Y: 109.77658476682018, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 464.52748879223947, Y: 93.95182584542647, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 464.52748879223947, Y: 73.95182584542647, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 464.52748879223947, Y: 53.95182584542647, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 465.4676899307966, Y: 36.47707795850499, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 480.77748879223947, Y: 28.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 496.0872876536823, Y: 36.477077958505106, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 497.0274887922394, Y: 53.95182584542647, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 497.0274887922394, Y: 73.95182584542647, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 497.0274887922394, Y: 93.95182584542647, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 500.69422845949316, Y: 111.65177462818485, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 488.9669078107514, Y: 125.40688702689965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 479.34826026608715, Y: 142.94204084463172, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 469.7296127214229, Y: 160.4771946623638, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 473.57380584130266, Y: 177.54975098111902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 467.4568528718194, Y: 193.94587510754383, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 453.36977440564675, Y: 204.3287562244542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 449.1528081755539, Y: 223.8791320728684, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 444.93584194546105, Y: 243.4295079212826, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 456.7818118008747, Y: 256.3106180514162, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 462.26461687296484, Y: 272.92954847853645, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 460.4092368820792, Y: 290.33091523777176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 451.54561846936014, Y: 305.42019184845486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 315.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 335.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.25, Y: 355.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.25, Y: 375.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 437.25, Y: 395.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 415.5140163257524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 435.5140163257523, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 144.35786437626905, Y: 429.6561519494833, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 211.0, Y: 343.16294346558686, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 296.0, Y: 435.5140163257524, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 381.0, Y: 335.5140163257524, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 389.78437717259465, Y: 186.60293909520334, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 477.02748879223947, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 479.67251011944796, Y: 205.9915294547035, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 453.5, Y: 355.5140163257524, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '83', X: 433.5, Y: 435.5140163257524, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TEX2, -18.7 ± 0.7
 kcal/mol, AUC: 0.702', X: 186.72211422974658, Y: 448.3140163257524, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 511.19422845949316, 448.3140163257524)
Updated viewBox: -0.25 -5.0 516.4442284594932 458.3140163257524
Updated SVG: /disk1/www/rails/humanrnamap/public/result/b59e1b5f-78c8-45a3-8ee4-1f15c49b41cd/final_image/TEX2_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/b59e1b5f-78c8-45a3-8ee4-1f15c49b41cd/final_image/TEX2_fold_final_1.svg
