Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 34% [==================                                ] \                     
 39% [====================                              ] |                     
 45% [=======================                           ] /                     
 51% [==========================                        ] -                     
 56% [=============================                     ] \                     
 62% [================================                  ] |                     
 68% [===================================               ] /                     
 73% [=====================================             ] -                     
 79% [========================================          ] \                     
 85% [===========================================       ] |                     
 90% [==============================================    ] /                     
 96% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/b6109c77-2cda-43fd-a142-dc50d1c2f4c0/final_image/TEX2_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.21 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.21 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.21 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 171.84 MB
Based on canonical annotations, the following gene is in your area of interest: TEX2(-)
write fasta - Elapsed time since the previous call: 0.57 seconds
write fasta - Current memory usage: 171.84 MB
Length of region: 88 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 175.24 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/b6109c77-2cda-43fd-a142-dc50d1c2f4c0/fasta/TEX2.fasta" "/disk1/www/rails/humanrnamap/public/result/b6109c77-2cda-43fd-a142-dc50d1c2f4c0/ct/TEX2.ct" --SHAPE "TEX2.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 175.24 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/b6109c77-2cda-43fd-a142-dc50d1c2f4c0/ct/TEX2.ct" "/disk1/www/rails/humanrnamap/public/result/b6109c77-2cda-43fd-a142-dc50d1c2f4c0/fold_FE/TEX2.txt" -sh "TEX2.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 175.24 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/b6109c77-2cda-43fd-a142-dc50d1c2f4c0/ct/TEX2.ct" 1 "/disk1/www/rails/humanrnamap/public/result/b6109c77-2cda-43fd-a142-dc50d1c2f4c0/fold_dbn/TEX2_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.24 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAUAAAUAUCUCAAUGUCAAAUACUAGAUAAGCAUCUAAGUCAUUUCUACGGAAUCCUGUUCAGAUAGGGGCACAAUAAAAUGAGUAC', '-structureDBN', '........................(((((....)))))..((((((........((((((....))))))........))))))....', '-o', '/disk1/www/rails/humanrnamap/public/result/b6109c77-2cda-43fd-a142-dc50d1c2f4c0/final_image/TEX2_fold_1.svg', '-title', 'TEX2, -16.8 ± 0.7\n kcal/mol, AUC: 0.664', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,7,9,11,15,16,17,22,25,27,29,32,35,37,40,41,44,45,46,48,51,52,55,58,59,60,61,64,66,68,69,70,71,77,82,83,85,86', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '65,67,5,74,13,78,79,80,20,21,87,88,26,28,30,36,38,39,47,49,53,54,57,62,63', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '81,34,4,42,75,76,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,6,8,72,10,73,12,14,18,19,84,23,24,33,43,50,56']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 179.75, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 197.25, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 214.75, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 232.25, Y: 360.8448359091302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 249.75, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 267.25, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.75, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 302.25, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 337.25, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 354.75, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 372.25, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 389.75, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 407.25, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 424.75, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 424.75, Y: 340.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 424.75, Y: 320.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 424.75, Y: 300.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 424.75, Y: 280.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 421.2012656127609, Y: 263.70839124153906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 432.24998212006705, Y: 250.1372042950053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 449.750017879933, Y: 250.1372042950053, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 460.7987343872391, Y: 263.70839124153906, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 280.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 457.25, Y: 300.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 457.25, Y: 320.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 457.25, Y: 340.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 474.75, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 492.25, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 509.75, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 509.75, Y: 340.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 509.75, Y: 320.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 509.75, Y: 300.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 509.75, Y: 280.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 509.75, Y: 260.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 493.7361958177398, Y: 253.7873063305542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 480.39696981723455, Y: 242.45965441818987, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 470.83810613419564, Y: 227.8009105010143, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 465.852007552393, Y: 211.02624302076913, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 465.852007552393, Y: 193.52622450248612, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 470.83810613419564, Y: 176.75155702224095, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 480.3969698172345, Y: 162.09281310506543, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 493.7361958177398, Y: 150.76516119270104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 509.75, Y: 143.70763161412503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 509.75, Y: 123.70763161412503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 509.75, Y: 103.70763161412503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 509.75, Y: 83.70763161412503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 509.75, Y: 63.707631614125035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 509.75, Y: 43.707631614125035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 506.20126561276084, Y: 26.571186946533885, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 517.249982120067, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 534.750017879933, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 545.798734387239, Y: 26.57118694653377, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 43.707631614125035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 542.25, Y: 63.707631614125035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 83.70763161412503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 542.25, Y: 103.70763161412503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 542.25, Y: 123.70763161412503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 542.25, Y: 143.70763161412498, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 558.2638041822602, Y: 150.76516119270104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 571.6030301827655, Y: 162.09281310506537, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 581.1618938658044, Y: 176.75155702224095, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 586.147992447607, Y: 193.52622450248606, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 586.147992447607, Y: 211.02624302076913, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 581.1618938658044, Y: 227.8009105010143, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 571.6030301827655, Y: 242.45965441818987, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 558.2638041822602, Y: 253.7873063305542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 260.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 280.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 300.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 542.25, Y: 320.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 542.25, Y: 340.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.25, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 559.75, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 577.25, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 594.75, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 612.25, Y: 360.84483590913027, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 380.8448359091302, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 380.8448359091302, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 380.84483590913027, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 398.02236236003057, Y: 258.9631074359015, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 488.5, Y: 380.84483590913027, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 442.3103355001617, Y: 213.90542995060332, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 486.1432874692888, Y: 41.31786855626842, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 555.9975402356077, Y: 134.0207288220409, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 558.5, Y: 280.84483590913027, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '88', X: 608.5, Y: 380.84483590913027, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TEX2, -16.8 ± 0.7
 kcal/mol, AUC: 0.664', X: 242.5, Y: 393.6448359091303, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 626.5, 393.6448359091303)
Updated viewBox: -0.25 0.0 631.75 398.6448359091303
Updated SVG: /disk1/www/rails/humanrnamap/public/result/b6109c77-2cda-43fd-a142-dc50d1c2f4c0/final_image/TEX2_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/b6109c77-2cda-43fd-a142-dc50d1c2f4c0/final_image/TEX2_fold_final_1.svg
