Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  9% [=====                                             ] -                     
 18% [==========                                        ] \                     
 28% [===============                                   ] |                     
 37% [===================                               ] /                     
 47% [========================                          ] -                     
 56% [=============================                     ] \                     
 66% [==================================                ] |                     
 75% [======================================            ] /                     
 84% [===========================================       ] -                     
 94% [================================================  ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/b8fdcd04-68f6-4e04-91bb-c7f93a129e98/final_image/DNAJC13_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.87 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.87 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.87 MB
read annotations - Elapsed time since the previous call: 0.11 seconds
read annotations - Current memory usage: 172.39 MB
Based on canonical annotations, the following gene is in your area of interest: DNAJC13(+)
write fasta - Elapsed time since the previous call: 0.63 seconds
write fasta - Current memory usage: 172.39 MB
Length of region: 53 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 175.60 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/b8fdcd04-68f6-4e04-91bb-c7f93a129e98/fasta/DNAJC13.fasta" "/disk1/www/rails/humanrnamap/public/result/b8fdcd04-68f6-4e04-91bb-c7f93a129e98/ct/DNAJC13.ct" --SHAPE "DNAJC13.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 175.60 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/b8fdcd04-68f6-4e04-91bb-c7f93a129e98/ct/DNAJC13.ct" "/disk1/www/rails/humanrnamap/public/result/b8fdcd04-68f6-4e04-91bb-c7f93a129e98/fold_FE/DNAJC13.txt" -sh "DNAJC13.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 175.60 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/b8fdcd04-68f6-4e04-91bb-c7f93a129e98/ct/DNAJC13.ct" 1 "/disk1/www/rails/humanrnamap/public/result/b8fdcd04-68f6-4e04-91bb-c7f93a129e98/fold_dbn/DNAJC13_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.60 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCAGGAAAGAAUAUUUCCCUCUCCUGCAUCAAGUCUGCGUGGCCAUCCUCCCC', '-structureDBN', '.(((((.((.........)).)))))......(((.....)))..........', '-o', '/disk1/www/rails/humanrnamap/public/result/b8fdcd04-68f6-4e04-91bb-c7f93a129e98/final_image/DNAJC13_fold_1.svg', '-title', 'DNAJC13, -8.8 ± 0.6\n kcal/mol, AUC: 0.652', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '4,5,9,12,14,15,16,20,22,25,26,29,33,34,36,37,39,40,41,42,46,49', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '35,8,45,18,50,51,23,24', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,3,6,7,44,47,17,19,52,21', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '32,2,38,10,11,43,13,48,53,27,28,30,31']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 11.999053020283771, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 29.499053020283768, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.499053020283768, Y: 188.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 29.499053020283768, Y: 168.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 29.499053020283768, Y: 148.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.499053020283768, Y: 128.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.820675868794513, Y: 112.1346635875615, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 29.499053020283768, Y: 95.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 29.499053020283768, Y: 75.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 16.921303520494195, Y: 63.791559873392316, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 12.174444557799792, Y: 46.94766465641487, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 16.54793276953392, Y: 30.002987705996134, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 28.85373551195464, Y: 17.56045199349535, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 45.74905302028374, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 62.64437052861284, Y: 17.56045199349535, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.95017327103359, Y: 30.00298770599619, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 79.32366148276772, Y: 46.94766465641487, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.5768025200733, Y: 63.79155987339226, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 61.99905302028377, Y: 75.95912715747875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 61.99905302028377, Y: 95.95912715747872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 68.67743017177303, Y: 112.1346635875615, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 61.99905302028377, Y: 128.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 61.99905302028377, Y: 148.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 61.99905302028377, Y: 168.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 61.99905302028377, Y: 188.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 61.99905302028377, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 79.49905302028377, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 96.99905302028377, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 114.49905302028377, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 131.99905302028378, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 149.49905302028378, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 166.99905302028378, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 184.49905302028378, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 184.49905302028378, Y: 188.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 184.49905302028378, Y: 168.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.85088341546586, Y: 152.1221597179897, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 184.57710267150532, Y: 135.96639349173626, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 200.74905302028378, Y: 129.27917959099182, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.92100336906228, Y: 135.96639349173626, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 223.6472226251017, Y: 152.1221597179897, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.99905302028378, Y: 168.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 216.99905302028378, Y: 188.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 216.99905302028378, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 234.49905302028378, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 251.99905302028378, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 269.4990530202838, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 286.9990530202838, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 304.4990530202838, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 321.9990530202838, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 339.4990530202838, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 356.9990530202838, Y: 208.31020001764426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 374.4990530202838, Y: 208.3102000176443, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 391.9990530202838, Y: 208.3102000176443, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 12.749053020283771, Y: 228.31020001764426, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: -4.0, Y: 74.04564858995136, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 78.24905302028377, Y: 95.95912715747872, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 128.24905302028378, Y: 228.31020001764426, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 239.8971643936287, Y: 152.07389735659342, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 335.7490530202838, Y: 228.31020001764426, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '53', X: 388.2490530202838, Y: 228.3102000176443, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'DNAJC13, -8.8 ± 0.6
 kcal/mol, AUC: 0.652', X: 135.99905302028378, Y: 241.1102000176443, Width: 142.5, Height: 23
Calculated bounding box: (-4.0, 5.0, 406.2490530202838, 241.1102000176443)
Updated viewBox: -9.0 0.0 420.2490530202838 246.1102000176443
Updated SVG: /disk1/www/rails/humanrnamap/public/result/b8fdcd04-68f6-4e04-91bb-c7f93a129e98/final_image/DNAJC13_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/b8fdcd04-68f6-4e04-91bb-c7f93a129e98/final_image/DNAJC13_fold_final_1.svg
