Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  7% [====                                              ] -                     
 14% [========                                          ] \                     
 22% [============                                      ] |                     
 29% [===============                                   ] /                     
 37% [===================                               ] -                     
 44% [=======================                           ] \                     
 52% [===========================                       ] |                     
 59% [==============================                    ] /                     
 67% [==================================                ] -                     
 74% [======================================            ] \                     
 82% [==========================================        ] |                     
 89% [=============================================     ] /                     
 97% [================================================= ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/b92fde56-94d1-4ee5-835a-5a8f9fa9f91e/final_image/BCOR_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.38 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.38 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.38 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 171.98 MB
Based on canonical annotations, the following gene is in your area of interest: BCOR(-)
write fasta - Elapsed time since the previous call: 0.27 seconds
write fasta - Current memory usage: 171.98 MB
Length of region: 67 nt.
93.30000000000001% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 174.95 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/b92fde56-94d1-4ee5-835a-5a8f9fa9f91e/fasta/BCOR.fasta" "/disk1/www/rails/humanrnamap/public/result/b92fde56-94d1-4ee5-835a-5a8f9fa9f91e/ct/BCOR.ct" --SHAPE "BCOR.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 174.95 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/b92fde56-94d1-4ee5-835a-5a8f9fa9f91e/ct/BCOR.ct" "/disk1/www/rails/humanrnamap/public/result/b92fde56-94d1-4ee5-835a-5a8f9fa9f91e/fold_FE/BCOR.txt" -sh "BCOR.dat"

efn2 - Elapsed time since the previous call: 0.44 seconds
efn2 - Current memory usage: 174.95 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/b92fde56-94d1-4ee5-835a-5a8f9fa9f91e/ct/BCOR.ct" 1 "/disk1/www/rails/humanrnamap/public/result/b92fde56-94d1-4ee5-835a-5a8f9fa9f91e/fold_dbn/BCOR_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 174.95 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGACUUUGAGCUAUUUUUUUCUGUACCCUGUAAAAUAUUGAAAACUAACAUAAUAUGUUGAGGUUGC', '-structureDBN', '.((((((((..((((.(((((.(((..........))).))))).......))))..))))))))..', '-o', '/disk1/www/rails/humanrnamap/public/result/b92fde56-94d1-4ee5-835a-5a8f9fa9f91e/final_image/BCOR_fold_1.svg', '-title', 'BCOR, -4.3 ± 0.9\n kcal/mol, AUC: 0.628', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,5,6,7,8,10,12,14,15,16,17,18,19,20,22,23,24,29,30,31,36,38,39,40,46,49,51,53,54,56,57,58,59,60,62,63,64,65,66', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '32,44,13', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,33,37,9,41,11,47,48,21,55,25', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '34,3,4,35,67,42,43,45,50,52,26,27,28,61']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 237.67801625391118, Y: 374.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 255.17801625391115, Y: 374.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 255.17801625391115, Y: 354.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 255.17801625391115, Y: 334.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 255.17801625391115, Y: 314.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 255.17801625391115, Y: 294.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 255.17801625391115, Y: 274.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 255.17801625391115, Y: 254.53666574725625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 255.17801625391115, Y: 234.53666574725625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 244.7983329365094, Y: 220.4472265261252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 244.7983329365094, Y: 202.94722300225428, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 255.17801625391115, Y: 188.85778378112317, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 255.17801625391115, Y: 168.85778378112317, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 255.17801625391115, Y: 148.8577837811232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 255.17801625391115, Y: 128.8577837811232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 241.35493077156892, Y: 118.12593404719792, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 233.65938904559053, Y: 102.40878009021765, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.07756535704615, Y: 98.34034291720366, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.49574166850175, Y: 94.27190574418967, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 174.91391797995735, Y: 90.20346857117568, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 155.33209429141297, Y: 86.13503139816169, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 138.13628061491855, Y: 89.38332208135375, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 123.65748827595152, Y: 79.5541831178283, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 104.07565032885967, Y: 75.48581457333376, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 84.49381238176781, Y: 71.41744602883921, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 70.65246478120397, Y: 82.12567694290158, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 53.409633206599864, Y: 85.11463528960849, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 36.77170538748433, Y: 79.68983385596891, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 24.604519111049594, Y: 67.11173023010178, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 19.735131266988642, Y: 50.30285832468746, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 23.29494858651938, Y: 33.1687749421402, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 34.456844250788066, Y: 19.690600069832954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 50.62734156577707, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 68.04921065060213, Y: 14.651541794726427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 82.67446424604177, Y: 24.261488203400972, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 91.1049112665714, Y: 39.59695936481489, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 110.68674921366326, Y: 43.66532790930944, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 130.26858716075517, Y: 47.73369645380399, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 147.46446812990433, Y: 44.48536185052592, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 161.94330469756065, Y: 54.314567904277055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 181.52512838610505, Y: 58.383005077291045, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 201.10695207464946, Y: 62.451442250305035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 220.68877576319383, Y: 66.51987942331903, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 240.2705994517382, Y: 70.58831659633302, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 253.58996908342885, Y: 59.23735220495212, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 270.5439278822968, Y: 54.89992427514312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 287.6780240015557, Y: 58.45980491583862, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 301.50110173625336, Y: 69.19165107297795, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 309.19664153627235, Y: 84.90879671671121, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 309.196639610311, Y: 102.4087967167111, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 301.5010963507936, Y: 118.12594066657982, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 287.67801625391115, Y: 128.8577837811232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 287.67801625391115, Y: 148.8577837811232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 287.67801625391115, Y: 168.85778378112317, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 287.67801625391115, Y: 188.85778378112317, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 298.0576995713129, Y: 202.94722300225428, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 298.0576995713129, Y: 220.4472265261252, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 287.67801625391115, Y: 234.53666574725625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 287.67801625391115, Y: 254.53666574725625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 287.67801625391115, Y: 274.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 287.67801625391115, Y: 294.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 287.67801625391115, Y: 314.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 287.67801625391115, Y: 334.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 287.67801625391115, Y: 354.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 287.67801625391115, Y: 374.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 305.17801625391115, Y: 374.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 322.67801625391115, Y: 374.5366657472563, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 238.42801625391118, Y: 394.5366657472563, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 222.04775057429896, Y: 226.69045244682172, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 167.09548080694339, Y: 109.78529225972005, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: -4.0, Y: 51.07391489928682, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 162.26172471344958, Y: 34.7327406510733, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 324.9305943578715, Y: 106.92272044169971, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 303.92801625391115, Y: 274.5366657472563, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '67', X: 318.92801625391115, Y: 394.5366657472563, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'BCOR, -4.3 ± 0.9
 kcal/mol, AUC: 0.628', X: 105.20657376044991, Y: 407.3366657472563, Width: 142.5, Height: 23
Calculated bounding box: (-4.0, 5.0, 342.9305943578715, 407.3366657472563)
Updated viewBox: -9.0 0.0 356.9305943578715 412.3366657472563
Updated SVG: /disk1/www/rails/humanrnamap/public/result/b92fde56-94d1-4ee5-835a-5a8f9fa9f91e/final_image/BCOR_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/b92fde56-94d1-4ee5-835a-5a8f9fa9f91e/final_image/BCOR_fold_final_1.svg
