Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  4% [===                                               ] -                     
  9% [=====                                             ] \                     
 14% [========                                          ] |                     
 19% [==========                                        ] /                     
 24% [=============                                     ] -                     
 29% [===============                                   ] \                     
 33% [=================                                 ] |                     
 38% [====================                              ] /                     
 43% [======================                            ] -                     
 48% [=========================                         ] \                     
 53% [===========================                       ] |                     
 58% [==============================                    ] /                     
 63% [================================                  ] -                     
 67% [==================================                ] \                     
 72% [=====================================             ] |                     
 77% [=======================================           ] /                     
 82% [==========================================        ] -                     
 87% [============================================      ] \                     
 92% [===============================================   ] |                     
 97% [================================================= ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/b97175ba-1fd0-425d-9d00-4ad14e15f1a1/final_image/MLLT6_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.18 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.18 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.18 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.87 MB
Based on canonical annotations, the following gene is in your area of interest: MLLT6(+)
write fasta - Elapsed time since the previous call: 0.57 seconds
write fasta - Current memory usage: 172.87 MB
Length of region: 103 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 176.51 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/b97175ba-1fd0-425d-9d00-4ad14e15f1a1/fasta/MLLT6.fasta" "/disk1/www/rails/humanrnamap/public/result/b97175ba-1fd0-425d-9d00-4ad14e15f1a1/ct/MLLT6.ct" --SHAPE "MLLT6.dat"

fold - Elapsed time since the previous call: 0.13 seconds
fold - Current memory usage: 176.51 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/b97175ba-1fd0-425d-9d00-4ad14e15f1a1/ct/MLLT6.ct" "/disk1/www/rails/humanrnamap/public/result/b97175ba-1fd0-425d-9d00-4ad14e15f1a1/fold_FE/MLLT6.txt" -sh "MLLT6.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.51 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/b97175ba-1fd0-425d-9d00-4ad14e15f1a1/ct/MLLT6.ct" 1 "/disk1/www/rails/humanrnamap/public/result/b97175ba-1fd0-425d-9d00-4ad14e15f1a1/fold_dbn/MLLT6_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.51 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACUGGGAAUUCCAAGGAAGGUGGGCAAGUAGCCUUGGCUCUCUCCCACCAUGUCCAUCAGGAUUGAGAGUGUGUCUAGCUCCCGACCACUUUGUCUUGACCUA', '-structureDBN', '..((((...)))).(((.((((((..((.(((....)))))..))))))...))).(((((((..((((((.(((........))))))))))))))))....', '-o', '/disk1/www/rails/humanrnamap/public/result/b97175ba-1fd0-425d-9d00-4ad14e15f1a1/final_image/MLLT6_fold_1.svg', '-title', 'MLLT6, -43.1 ± 1.4\n kcal/mol, AUC: 0.775', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,4,5,6,9,10,15,16,19,20,21,22,23,24,28,29,31,34,35,36,37,39,41,43,51,52,53,57,60,61,63,64,65,67,69,70,71,72,73,74,76,78,80,84,90,91,92,93,94,96,97,98,102', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '12,13,81,82,87,88,89,27,32,33,38,40,44,45,46,55,62', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '66,68,101,42,75,47,79,49,18,83,85,86,58,30', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,7,8,11,77,14,17,25,26,95,99,100,103,48,50,54,56,59']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 38.24247390799232, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 55.74247390799232, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.24247390799232, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 73.24247390799232, Y: 301.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 73.24247390799232, Y: 281.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 73.24247390799232, Y: 261.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.18267504654946, Y: 243.70210811226997, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.49247390799232, Y: 235.22503015376486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 104.80227276943518, Y: 243.70210811226997, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 105.74247390799232, Y: 261.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 105.74247390799232, Y: 281.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 105.74247390799232, Y: 301.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 105.74247390799232, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 123.24247390799232, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 140.74247390799232, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 140.74247390799232, Y: 301.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 140.74247390799232, Y: 281.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 130.3627882748391, Y: 267.0874097303182, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 130.3627952220991, Y: 249.58739915870703, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 118.50031091403116, Y: 233.48517986940277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 106.63782660596326, Y: 217.38296058009848, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 94.77534229789535, Y: 201.28074129079425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 82.91285798982742, Y: 185.17852200148997, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 71.05037368175948, Y: 169.07630271218568, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 54.33678622942361, Y: 163.88918008551366, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 43.95711107633511, Y: 149.79973047286478, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 43.95712612872876, Y: 132.2997234251295, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 32.09464821301816, Y: 116.19749942658575, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 18.892668933604227, Y: 104.71011447903368, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 19.32086054264036, Y: 87.21528890764625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 15.439061494856304, Y: 67.59561418677936, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 11.557262447072276, Y: 47.97593946591246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 31.854139641659913, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 12.954580169503174, Y: 16.39658110744176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 30.121830630108633, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 43.59447285624725, Y: 24.168668812488477, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 43.439233868480926, Y: 41.668016013263355, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 47.32103291626498, Y: 61.28769073413025, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 51.20283196404904, Y: 80.90736545499715, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 58.26076221065176, Y: 96.92097281355603, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 70.12324012636236, Y: 113.02319681209974, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 86.83681947485934, Y: 118.21032177314464, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 97.21649044776265, Y: 132.29976571157846, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 97.21648002687891, Y: 149.79976571157533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.07896433494685, Y: 165.90198500087962, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 120.94144864301478, Y: 182.0042042901839, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 132.8039329510827, Y: 198.10642357948814, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.6664172591506, Y: 214.20864286879237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 156.52890156721853, Y: 230.31086215809665, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 173.24248297493043, Y: 235.49798048408337, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 183.62215954114555, Y: 249.5874203019315, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 183.62215606751766, Y: 267.08742030193116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 173.24247390799232, Y: 281.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 173.24247390799232, Y: 301.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 173.24247390799232, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 190.74247390799232, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 208.24247390799232, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 208.24247390799232, Y: 301.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.24247390799232, Y: 281.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 208.24247390799232, Y: 261.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 208.24247390799232, Y: 241.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.24247390799232, Y: 221.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 208.24247390799232, Y: 201.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 201.56410347407973, Y: 184.98376832364954, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 208.2672570879332, Y: 168.80092395841427, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 224.43982021275247, Y: 162.07300287578573, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 238.58195583648342, Y: 147.93086725205478, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 252.72409146021437, Y: 133.78873162832377, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 266.8662270839453, Y: 119.64659600459277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 281.00836270767627, Y: 105.50446038086181, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 295.1504983314072, Y: 91.36232475713086, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 304.52914746032366, Y: 76.58757567824648, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 321.8904929779991, Y: 74.38849595181227, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 340.70662255970933, Y: 67.60961200500458, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 359.5227521414196, Y: 60.83072805819688, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 367.8537296549961, Y: 45.440948244225524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 383.2137531203001, Y: 37.055234905484326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 400.6643294579642, Y: 38.369728928898326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 414.5948194219483, Y: 48.96179947329938, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 420.5263478051452, Y: 65.42592654076225, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 416.5518334148303, Y: 82.46863009434827, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 403.949146161473, Y: 94.61040850808558, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 386.7702514553298, Y: 97.94748593144243, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 370.5384385549821, Y: 91.40693862847604, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 351.7223089732719, Y: 98.18582257528374, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.9061793915615, Y: 104.96470652209143, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 318.13146871997003, Y: 114.34329514569356, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 303.9893330962391, Y: 128.48543076942457, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 289.8471974725081, Y: 142.62756639315558, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 275.7050618487772, Y: 156.76970201688653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 261.5629262250462, Y: 170.91183764061748, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 247.42079060131528, Y: 185.05397326434849, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 240.74247390799235, Y: 201.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 240.74247390799235, Y: 221.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 240.74247390799235, Y: 241.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 240.74247390799235, Y: 261.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 240.74247390799235, Y: 281.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 240.74247390799235, Y: 301.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 240.74247390799235, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 258.24247390799235, Y: 321.1768559991914, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 275.74247390799235, Y: 321.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 293.24247390799235, Y: 321.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.74247390799235, Y: 321.17685599919145, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 38.99247390799232, Y: 341.1768559991914, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 121.21514837258633, Y: 255.65519081301386, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 98.64809162472689, Y: 245.34766417747068, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: -3.50469300592054, Y: 93.22555153218985, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 70.61298620919553, Y: 85.05849489784543, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 181.08704953371702, Y: 219.20178380160965, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 184.49247390799232, Y: 261.17685599919145, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 263.1162270839453, Y: 91.36232475713086, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 436.74232173758, Y: 64.25978549897877, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 286.0971974725081, Y: 170.91183764061748, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '100', X: 249.99247390799235, Y: 341.1768559991914, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '103', X: 302.49247390799235, Y: 341.17685599919145, Width: 27.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MLLT6, -43.1 ± 1.4
 kcal/mol, AUC: 0.775', X: 146.6381739025726, Y: 353.97685599919146, Width: 142.5, Height: 23
Calculated bounding box: (-3.50469300592054, 5.0, 454.74232173758, 353.97685599919146)
Updated viewBox: -8.50469300592054 0.0 468.2470147435006 358.97685599919146
Updated SVG: /disk1/www/rails/humanrnamap/public/result/b97175ba-1fd0-425d-9d00-4ad14e15f1a1/final_image/MLLT6_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/b97175ba-1fd0-425d-9d00-4ad14e15f1a1/final_image/MLLT6_fold_final_1.svg
