Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 15% [========                                          ] |                     
 20% [===========                                       ] /                     
 25% [=============                                     ] -                     
 30% [================                                  ] \                     
 36% [===================                               ] |                     
 41% [=====================                             ] /                     
 46% [========================                          ] -                     
 51% [==========================                        ] \                     
 56% [=============================                     ] |                     
 61% [===============================                   ] /                     
 67% [==================================                ] -                     
 72% [=====================================             ] \                     
 77% [=======================================           ] |                     
 82% [==========================================        ] /                     
 87% [============================================      ] -                     
 92% [===============================================   ] \                     
 97% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/ba175783-21ac-4175-80a1-8fd41fefab8d/final_image/CLOCK_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.36 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.36 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.36 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 173.01 MB
Based on canonical annotations, the following gene is in your area of interest: CLOCK(-)
write fasta - Elapsed time since the previous call: 0.33 seconds
write fasta - Current memory usage: 173.01 MB
Length of region: 97 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.21 seconds
write dat - Current memory usage: 176.14 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/ba175783-21ac-4175-80a1-8fd41fefab8d/fasta/CLOCK.fasta" "/disk1/www/rails/humanrnamap/public/result/ba175783-21ac-4175-80a1-8fd41fefab8d/ct/CLOCK.ct" --SHAPE "CLOCK.dat"

fold - Elapsed time since the previous call: 0.15 seconds
fold - Current memory usage: 176.14 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/ba175783-21ac-4175-80a1-8fd41fefab8d/ct/CLOCK.ct" "/disk1/www/rails/humanrnamap/public/result/ba175783-21ac-4175-80a1-8fd41fefab8d/fold_FE/CLOCK.txt" -sh "CLOCK.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.14 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/ba175783-21ac-4175-80a1-8fd41fefab8d/ct/CLOCK.ct" 1 "/disk1/www/rails/humanrnamap/public/result/ba175783-21ac-4175-80a1-8fd41fefab8d/fold_dbn/CLOCK_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.14 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAGCCCCUUCAAUUAUUUCCCAUCUCCACAAAUAGUCGGGGGAAAAAAUUAAAAUUUUCCUUUAUGAUUCUUACUGUUCUUCGCAGCUCAUCUUUUC', '-structureDBN', '..................(((..((........))..)))((((((........)))))).............((((.....))))...........', '-o', '/disk1/www/rails/humanrnamap/public/result/ba175783-21ac-4175-80a1-8fd41fefab8d/final_image/CLOCK_fold_1.svg', '-title', 'CLOCK, -14.8 ± 0.6\n kcal/mol, AUC: 0.665', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,8,9,13,14,16,17,18,23,25,33,35,36,38,39,40,41,42,49,50,55,56,57,58,61,62,63,65,66,68,69,71,72,75,76,77,78,80,81,83,86,88,91,93,94,95,96', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '5,43,44,79,19,20,51,52,84,85,92,30', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,6,73,82,21,26,27,28,90,32,97,37,45,46,47,48,53,54,59,60', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,2,67,4,70,7,10,11,12,74,15,22,87,24,89,29,31,34']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.25, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.25, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 267.25, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 284.75, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 168.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 148.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 309.37031668259823, Y: 134.60387930793533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 309.37031668259823, Y: 117.1038757840644, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 319.75, Y: 103.01443656293333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 319.75, Y: 83.01443656293333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 308.0949319257163, Y: 69.96032237475319, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 305.4117893094517, Y: 52.66722390296343, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 312.56324539329535, Y: 36.69514874238743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 327.2499927277997, Y: 27.179374376280208, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 344.7500072722003, Y: 27.17937437628018, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 359.43675460670465, Y: 36.69514874238743, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 366.5882106905483, Y: 52.66722390296343, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 363.9050680742837, Y: 69.96032237475316, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 352.25, Y: 83.01443656293333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 103.01443656293333, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 362.62968331740177, Y: 117.1038757840644, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 362.62968331740177, Y: 134.60387930793533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 148.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 168.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 188.6933185290664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.75, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 369.75, Y: 168.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 148.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 128.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 108.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 88.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 358.0949319257163, Y: 75.6392043408863, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 355.4117893094517, Y: 58.346105869096505, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 362.5632453932954, Y: 42.374030708520536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 377.2499927277997, Y: 32.85825634241331, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 394.7500072722003, Y: 32.85825634241331, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 409.43675460670465, Y: 42.374030708520536, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 416.5882106905483, Y: 58.34610586909653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 413.9050680742837, Y: 75.6392043408863, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 88.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 108.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 128.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 402.25, Y: 148.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 168.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 402.25, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 419.75, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 437.25, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 454.75, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 489.75, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 524.75, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 542.25, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 559.75, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 577.25, Y: 188.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 594.75, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 612.25, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 629.75, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 647.25, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 647.25, Y: 168.69331852906643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 647.25, Y: 148.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 647.25, Y: 128.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 640.6018303951821, Y: 112.50527822941183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 647.3280496512215, Y: 96.34951200315842, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 663.5, Y: 89.66229810241398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 679.6719503487785, Y: 96.34951200315842, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 686.3981696048179, Y: 112.50527822941183, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 679.75, Y: 128.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 679.75, Y: 148.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 679.75, Y: 168.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 679.75, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 697.25, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 714.75, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 732.25, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 749.75, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 767.25, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 784.75, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 802.25, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 819.75, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 837.25, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 854.75, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 872.25, Y: 188.69331852906646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 208.6933185290664, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 208.6933185290664, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 296.0, Y: 168.6933185290664, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 346.67024523321106, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 348.5, Y: 208.6933185290664, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 367.82975476678894, Y: 13.678881966133133, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 412.64213562373095, Y: 202.83545415279738, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 573.5, Y: 208.69331852906643, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 659.75, Y: 69.66229810241398, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 746.0, Y: 208.69331852906646, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '97', X: 868.5, Y: 208.69331852906646, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLOCK, -14.8 ± 0.6
 kcal/mol, AUC: 0.665', X: 372.5, Y: 221.49331852906647, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 886.5, 221.49331852906647)
Updated viewBox: -0.25 -5.0 891.75 231.49331852906647
Updated SVG: /disk1/www/rails/humanrnamap/public/result/ba175783-21ac-4175-80a1-8fd41fefab8d/final_image/CLOCK_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/ba175783-21ac-4175-80a1-8fd41fefab8d/final_image/CLOCK_fold_final_1.svg
