Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 17% [=========                                         ] |                     
 23% [============                                      ] /                     
 29% [===============                                   ] -                     
 35% [==================                                ] \                     
 41% [=====================                             ] |                     
 47% [========================                          ] /                     
 52% [===========================                       ] -                     
 58% [==============================                    ] \                     
 64% [=================================                 ] |                     
 70% [====================================              ] /                     
 76% [=======================================           ] -                     
 82% [==========================================        ] \                     
 88% [=============================================     ] |                     
 94% [================================================  ] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/bbbfb512-0c26-4216-bbd3-625448b7f275/final_image/CALD1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.66 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.66 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.66 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.25 MB
Based on canonical annotations, the following gene is in your area of interest: CALD1(+)
write fasta - Elapsed time since the previous call: 0.84 seconds
write fasta - Current memory usage: 172.25 MB
Length of region: 85 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.17 seconds
write dat - Current memory usage: 175.40 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/bbbfb512-0c26-4216-bbd3-625448b7f275/fasta/CALD1.fasta" "/disk1/www/rails/humanrnamap/public/result/bbbfb512-0c26-4216-bbd3-625448b7f275/ct/CALD1.ct" --SHAPE "CALD1.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 175.40 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/bbbfb512-0c26-4216-bbd3-625448b7f275/ct/CALD1.ct" "/disk1/www/rails/humanrnamap/public/result/bbbfb512-0c26-4216-bbd3-625448b7f275/fold_FE/CALD1.txt" -sh "CALD1.dat"

efn2 - Elapsed time since the previous call: 0.51 seconds
efn2 - Current memory usage: 175.40 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/bbbfb512-0c26-4216-bbd3-625448b7f275/ct/CALD1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/bbbfb512-0c26-4216-bbd3-625448b7f275/fold_dbn/CALD1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.40 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AGGGGUUUCUAGCCGCAUCAAUGAAUGGCUAACUAAAACCCCAGAUGGAAACAAGUCACCUGCUCCCAAACCUUCUGACUUGAGA', '-structureDBN', '.(((((((.(((((............)))))....))))))).........(((((((.................)))))))...', '-o', '/disk1/www/rails/humanrnamap/public/result/bbbfb512-0c26-4216-bbd3-625448b7f275/final_image/CALD1_fold_1.svg', '-title', 'CALD1, -20.3 ± 0.8\n kcal/mol, AUC: 0.62', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,4,5,6,7,8,10,12,15,18,22,23,26,27,28,30,34,44,46,47,48,55,56,61,62,64,73,74,76,77,80,81,82,84', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '66,67,36,37,38,68,40,11,49', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '65,35,69,70,72,41,42,43,75,13,78,83,60,31', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,71,9,14,79,16,17,19,20,21,85,24,25,29,32,33,39,45,50,51,52,53,54,57,58,59,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 120.06120984598661, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 137.5612098459866, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 137.5612098459866, Y: 282.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 137.5612098459866, Y: 262.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 137.5612098459866, Y: 242.50963707709016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 137.5612098459866, Y: 222.50963707709016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 137.5612098459866, Y: 202.50963707709016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 137.5612098459866, Y: 182.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 125.47230327643322, Y: 168.23222807200654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 123.92479836362656, Y: 149.58842753427626, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.78266273989558, Y: 135.4462919105453, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 95.64052711616463, Y: 121.30415628681436, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 81.49839149243368, Y: 107.16202066308341, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 67.3562558687027, Y: 93.01988503935246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 50.123807199985094, Y: 96.06814022750274, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 33.15409414296158, Y: 91.79286414584891, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 19.4228862303296, Y: 80.94375929465747, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 11.3380562420374, Y: 65.4232995439773, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 10.317341217913114, Y: 47.95311672720055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 16.539731377776608, Y: 31.596741593617026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 28.91408281153008, Y: 19.222390159863494, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 45.27045794511355, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 62.74064076189023, Y: 14.020715024124343, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 78.2611005125705, Y: 22.105545012416428, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.11020536376193, Y: 35.83675292504847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 93.38548144541573, Y: 52.806465982071984, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 90.33722625726551, Y: 70.03891465078965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 104.47936188099646, Y: 84.1810502745206, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 118.62149750472742, Y: 98.32318589825155, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 132.7636331284584, Y: 112.4653215219825, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 146.90576875218935, Y: 126.60745714571351, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 163.89570084426813, Y: 127.52516570063091, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 177.78273824767916, Y: 137.35624771847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 184.29398165518745, Y: 153.07577986078894, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 181.4259880978595, Y: 169.84702294054733, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 170.0612098459866, Y: 182.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 170.0612098459866, Y: 202.50963707709016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 170.0612098459866, Y: 222.50963707709016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 170.0612098459866, Y: 242.50963707709016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 170.0612098459866, Y: 262.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 170.0612098459866, Y: 282.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 170.0612098459866, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 187.5612098459866, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 205.0612098459866, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 222.5612098459866, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 240.0612098459866, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 257.56120984598664, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 275.06120984598664, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 292.56120984598664, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.06120984598664, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 327.56120984598664, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 345.06120984598664, Y: 302.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 345.06120984598664, Y: 282.50963707709013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 345.06120984598664, Y: 262.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 345.06120984598664, Y: 242.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 345.06120984598664, Y: 222.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 345.06120984598664, Y: 202.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 345.06120984598664, Y: 182.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 329.3392410606849, Y: 174.82390161882142, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 316.78549625251384, Y: 162.6315136938984, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 308.6439737367199, Y: 147.14066338975726, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 305.7214479418063, Y: 129.8863979751256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 308.30752306322955, Y: 112.57850822834115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 316.1459350822997, Y: 96.93209876674945, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 328.45994594237044, Y: 84.49763180758515, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 344.029313476827, Y: 76.50728597042001, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 361.31120984598664, Y: 73.75285501174335, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 378.5931062151463, Y: 76.50728597042001, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 394.1624737496027, Y: 84.49763180758515, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 406.4764846096736, Y: 96.93209876674945, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 414.3148966287436, Y: 112.5785082283412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 416.9009717501669, Y: 129.8863979751256, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 413.97844595525333, Y: 147.14066338975732, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 405.8369234394593, Y: 162.6315136938984, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 393.2831786312883, Y: 174.82390161882142, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 377.56120984598664, Y: 182.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 377.56120984598664, Y: 202.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 377.56120984598664, Y: 222.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 377.56120984598664, Y: 242.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 377.56120984598664, Y: 262.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 377.56120984598664, Y: 282.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 377.56120984598664, Y: 302.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 395.06120984598664, Y: 302.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 412.56120984598664, Y: 302.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 430.06120984598664, Y: 302.5096370770902, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 120.81120984598661, Y: 322.50963707709013, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 103.54540611757551, Y: 160.6998321946681, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: -4.0, Y: 20.729132828939157, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 143.15576875218935, Y: 98.32318589825155, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 186.3112098459866, Y: 262.50963707709013, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 306.31120984598664, Y: 322.50963707709013, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 297.016861701235, Y: 174.6066273515041, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 418.97520860437805, Y: 85.27109672816306, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 393.81120984598664, Y: 262.5096370770902, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '85', X: 426.31120984598664, Y: 322.5096370770902, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CALD1, -20.3 ± 0.8
 kcal/mol, AUC: 0.62', X: 158.68927553194987, Y: 335.3096370770902, Width: 133.5, Height: 23
Calculated bounding box: (-4.0, 5.0, 444.31120984598664, 335.3096370770902)
Updated viewBox: -9.0 0.0 458.31120984598664 340.3096370770902
Updated SVG: /disk1/www/rails/humanrnamap/public/result/bbbfb512-0c26-4216-bbd3-625448b7f275/final_image/CALD1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/bbbfb512-0c26-4216-bbd3-625448b7f275/final_image/CALD1_fold_final_1.svg
