Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  9% [=====                                             ] -                     
 18% [==========                                        ] \                     
 27% [==============                                    ] |                     
 36% [===================                               ] /                     
 45% [=======================                           ] -                     
 54% [============================                      ] \                     
 63% [================================                  ] |                     
 72% [=====================================             ] /                     
 81% [=========================================         ] -                     
 90% [==============================================    ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/bbda5cef-dcee-4ead-aab1-0fa5c1e6d672/final_image/HCFC1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.05 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.05 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.05 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.63 MB
Based on canonical annotations, the following gene is in your area of interest: HCFC1(-)
write fasta - Elapsed time since the previous call: 0.25 seconds
write fasta - Current memory usage: 170.63 MB
Length of region: 55 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.16 seconds
write dat - Current memory usage: 173.71 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/bbda5cef-dcee-4ead-aab1-0fa5c1e6d672/fasta/HCFC1.fasta" "/disk1/www/rails/humanrnamap/public/result/bbda5cef-dcee-4ead-aab1-0fa5c1e6d672/ct/HCFC1.ct" --SHAPE "HCFC1.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 173.71 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/bbda5cef-dcee-4ead-aab1-0fa5c1e6d672/ct/HCFC1.ct" "/disk1/www/rails/humanrnamap/public/result/bbda5cef-dcee-4ead-aab1-0fa5c1e6d672/fold_FE/HCFC1.txt" -sh "HCFC1.dat"

efn2 - Elapsed time since the previous call: 0.40 seconds
efn2 - Current memory usage: 173.71 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/bbda5cef-dcee-4ead-aab1-0fa5c1e6d672/ct/HCFC1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/bbda5cef-dcee-4ead-aab1-0fa5c1e6d672/fold_dbn/HCFC1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.71 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'ACUCAAUAUUACCAUAGUGCGAUGUCGUUUUGUGCUAUUUUGAACAAUUAAAAGA', '-structureDBN', '..((((...((.(((((.(((....))).))))).))..))))............', '-o', '/disk1/www/rails/humanrnamap/public/result/bbda5cef-dcee-4ead-aab1-0fa5c1e6d672/final_image/HCFC1_fold_1.svg', '-title', 'HCFC1, -7.5 ± 0.8\n kcal/mol, AUC: 0.709', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,7,9,10,15,17,18,19,21,23,24,25,27,28,29,30,31,32,33,34,36,38,39,40,41,42,48,49,54', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '16,1,2,4,11,14', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '51,20,22,55,43,44,13', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '35,5,6,37,8,12,45,46,47,50,52,53,26']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 332.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 312.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 292.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 28.168842939098667, Y: 278.9558857139691, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 25.646478085278588, Y: 261.6386525334707, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 33.00391259362138, Y: 245.76045846301705, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 47.84636746724807, Y: 236.48951337592385, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 53.55151862538577, Y: 217.3204953973523, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 51.76480459982429, Y: 199.91201891748514, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 62.779836084355054, Y: 186.3136189471202, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 68.4849200607251, Y: 167.1445809738007, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.19000403709512, Y: 147.97554300048117, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 79.89508801346514, Y: 128.80650502716168, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 85.60017198983516, Y: 109.6374670538421, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 83.8133969527287, Y: 92.22899683598564, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 94.828380778826, Y: 78.63055826128004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 100.53339757335829, Y: 59.46150029344801, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 106.23841436789056, Y: 40.29244232561598, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 107.72530484017834, Y: 22.855687801909312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 122.18617167269863, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 138.95913166869883, Y: 17.991899895747565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 145.6776135560479, Y: 34.150899020877546, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 137.3881335656176, Y: 49.56309461673095, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 131.68311677108534, Y: 68.73215258456298, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 125.97809997655307, Y: 87.90121055239501, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 127.76491310323132, Y: 105.309751526593, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 116.74985869647938, Y: 118.9082285154434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 111.04477472010936, Y: 138.07726648876294, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 105.33969074373934, Y: 157.24630446208246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 99.63460676736932, Y: 176.41534243540198, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 93.9295227909993, Y: 195.5843804087215, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 95.7162749058846, Y: 212.9929276450636, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 84.70117284056457, Y: 226.591366029326, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 78.99602168242686, Y: 245.76038400789756, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 86.35351237168118, Y: 261.63858701571735, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 83.83117097893486, Y: 278.95585567732905, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 72.25, Y: 292.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 72.25, Y: 312.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 72.25, Y: 332.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 72.25, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 89.75, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 107.25, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 124.75, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 142.25, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 159.75, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 177.25, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.75, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 352.075553797205, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 247.25, Y: 352.07555379720503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 264.75, Y: 352.07555379720503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 352.07555379720503, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 372.075553797205, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 26.60482308581308, Y: 226.79178811933454, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 77.61433960552624, Y: 53.75648349891577, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 132.16890166844925, Y: 124.61329569636013, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 88.03113818316078, Y: 296.38074151323775, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 191.0, Y: 372.075553797205, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '55', X: 278.5, Y: 372.07555379720503, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'HCFC1, -7.5 ± 0.8
 kcal/mol, AUC: 0.709', X: 77.5, Y: 384.87555379720504, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 296.5, 384.87555379720504)
Updated viewBox: -0.25 0.0 301.75 389.87555379720504
Updated SVG: /disk1/www/rails/humanrnamap/public/result/bbda5cef-dcee-4ead-aab1-0fa5c1e6d672/final_image/HCFC1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/bbda5cef-dcee-4ead-aab1-0fa5c1e6d672/final_image/HCFC1_fold_final_1.svg
