Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 24% [=============                                     ] /                     
 30% [================                                  ] -                     
 37% [===================                               ] \                     
 43% [======================                            ] |                     
 49% [=========================                         ] /                     
 55% [============================                      ] -                     
 61% [===============================                   ] \                     
 67% [==================================                ] |                     
 74% [======================================            ] /                     
 80% [=========================================         ] -                     
 86% [============================================      ] \                     
 92% [===============================================   ] |                     
 98% [==================================================] /                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/c2de24de-8b59-42c4-834b-ff2770117971/final_image/TNRC18_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.68 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.68 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.68 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 173.33 MB
Based on canonical annotations, the following gene is in your area of interest: TNRC18(-)
write fasta - Elapsed time since the previous call: 0.42 seconds
write fasta - Current memory usage: 173.33 MB
Length of region: 81 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.20 seconds
write dat - Current memory usage: 176.68 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/c2de24de-8b59-42c4-834b-ff2770117971/fasta/TNRC18.fasta" "/disk1/www/rails/humanrnamap/public/result/c2de24de-8b59-42c4-834b-ff2770117971/ct/TNRC18.ct" --SHAPE "TNRC18.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 176.68 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/c2de24de-8b59-42c4-834b-ff2770117971/ct/TNRC18.ct" "/disk1/www/rails/humanrnamap/public/result/c2de24de-8b59-42c4-834b-ff2770117971/fold_FE/TNRC18.txt" -sh "TNRC18.dat"

efn2 - Elapsed time since the previous call: 0.42 seconds
efn2 - Current memory usage: 176.68 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/c2de24de-8b59-42c4-834b-ff2770117971/ct/TNRC18.ct" 1 "/disk1/www/rails/humanrnamap/public/result/c2de24de-8b59-42c4-834b-ff2770117971/fold_dbn/TNRC18_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.68 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCACCAAGACCAGCCGCUGCGCCAAGGGCGGCCCCCUGAGCCCGCGCAAGGACGCCGGGCGUGCAAAGGACAGGAAGGACC', '-structureDBN', '............((((((........))))))((((((.(((((.((......)))))))..........))))..))...', '-o', '/disk1/www/rails/humanrnamap/public/result/c2de24de-8b59-42c4-834b-ff2770117971/final_image/TNRC18_fold_1.svg', '-title', 'TNRC18, -34.2 ± 1.0\n kcal/mol, AUC: 0.903', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '68,69,8,73,74,13,77,78,16,18,19,21,26,27,28,30,31,37,38,40,44,46,50,51,54,57,58,59,61,62,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,11,14,15,80,81,29,32,33,34,35,41,42,43,47,55,56,60', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,3,36,70,72,76,79,17,20,52,22,23,53', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,65,66,67,4,5,6,7,71,9,10,75,12,24,25,39,45,48,49']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 92.25, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 127.25, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 179.75, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 160.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 140.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 214.75, Y: 120.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 100.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 214.75, Y: 80.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 203.0949319257163, Y: 67.3645378042786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 200.4117893094517, Y: 50.071439332488865, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 207.56324539329538, Y: 34.09936417191284, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 222.24999272779968, Y: 24.583589805805616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 239.75000727220032, Y: 24.583589805805616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 254.43675460670465, Y: 34.099364171912896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 261.5882106905483, Y: 50.071439332488865, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 258.9050680742837, Y: 67.36453780427863, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 80.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 100.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 120.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 140.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 160.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 160.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 258.0716833066771, Y: 144.29576925761586, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 243.92954768294607, Y: 130.1536336338849, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.78741205921511, Y: 116.01149801015396, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 215.64527643548416, Y: 101.869362386423, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 195.96368897741732, Y: 106.19040515624846, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 176.28210151935045, Y: 101.86936238642306, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.13996589561947, Y: 116.01149801015399, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 147.99783027188852, Y: 130.15363363388494, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 133.85569464815757, Y: 144.2957692576159, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 119.71355902442662, Y: 158.43790488134684, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 110.33490989551012, Y: 173.2126539602312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.97356437783473, Y: 175.4117336866654, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.15743479612443, Y: 182.19061763347307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 62.950749957390684, Y: 195.63157618353074, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 45.719684237017816, Y: 198.68763998510016, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 30.574209797517113, Y: 189.92044226738537, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 24.6426945579519, Y: 173.456351682665, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 30.716865057761368, Y: 157.04435593082798, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 45.937852642898235, Y: 148.4089237614353, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 63.14174838256197, Y: 151.61440706319382, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 81.95787796427227, Y: 144.83552311638616, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 96.7325886358638, Y: 135.45693449278406, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 110.87472425959476, Y: 121.3147988690531, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 125.01685988332571, Y: 107.17266324532216, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 139.15899550705666, Y: 93.0305276215912, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 153.3011311307876, Y: 78.88839199786025, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 149.08883013557536, Y: 62.40154012258438, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 151.02526158038012, Y: 45.49562406662562, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 158.856417258314, Y: 30.38824953696235, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 171.55505821550196, Y: 19.061101516741985, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 187.45546112974603, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 204.47191682508847, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 220.37231973933262, Y: 19.061101516741985, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 233.07096069652053, Y: 30.38824953696229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 240.9021163744544, Y: 45.49562406662557, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 242.83854781925925, Y: 62.40154012258432, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 238.62624682404692, Y: 78.8883919978602, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 252.76838244777787, Y: 93.03052762159115, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 266.9105180715089, Y: 107.1726632453221, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 281.0526536952398, Y: 121.31479886905305, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 297.22521682005913, Y: 128.04271995168165, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 303.9283704339126, Y: 144.22556431691692, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 297.25, Y: 160.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 297.25, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 314.75, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 332.25, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.75, Y: 180.41865199245876, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 200.41865199245876, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 200.41865199245876, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 176.83981339315883, Y: 47.40887087817535, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 263.5, Y: 140.41865199245876, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 180.18577016665228, Y: 120.34695303664878, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 11.475028320111363, Y: 202.74240108706906, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 130.82387172678153, Y: 71.86772570362112, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 259.04225857229375, Y: 63.76147658589235, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 328.5, Y: 200.41865199245876, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '81', X: 346.0, Y: 200.41865199245876, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'TNRC18, -34.2 ± 1.0
 kcal/mol, AUC: 0.903', X: 111.25, Y: 216.48763998510017, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 364.0, 216.48763998510017)
Updated viewBox: -0.25 0.0 369.25 221.48763998510017
Updated SVG: /disk1/www/rails/humanrnamap/public/result/c2de24de-8b59-42c4-834b-ff2770117971/final_image/TNRC18_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/c2de24de-8b59-42c4-834b-ff2770117971/final_image/TNRC18_fold_final_1.svg
