Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 13% [=======                                           ] \                     
 20% [===========                                       ] |                     
 27% [==============                                    ] /                     
 34% [==================                                ] -                     
 41% [=====================                             ] \                     
 48% [=========================                         ] |                     
 55% [============================                      ] /                     
 62% [================================                  ] -                     
 69% [===================================               ] \                     
 76% [=======================================           ] |                     
 83% [==========================================        ] /                     
 90% [==============================================    ] -                     
 97% [================================================= ] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/c442bc83-8681-46d4-a7c3-41a5354d5337/final_image/MLLT6_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.25 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.25 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.25 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.87 MB
Based on canonical annotations, the following gene is in your area of interest: MLLT6(+)
write fasta - Elapsed time since the previous call: 1.16 seconds
write fasta - Current memory usage: 172.87 MB
Length of region: 72 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 176.39 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/c442bc83-8681-46d4-a7c3-41a5354d5337/fasta/MLLT6.fasta" "/disk1/www/rails/humanrnamap/public/result/c442bc83-8681-46d4-a7c3-41a5354d5337/ct/MLLT6.ct" --SHAPE "MLLT6.dat"

fold - Elapsed time since the previous call: 0.07 seconds
fold - Current memory usage: 176.39 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/c442bc83-8681-46d4-a7c3-41a5354d5337/ct/MLLT6.ct" "/disk1/www/rails/humanrnamap/public/result/c442bc83-8681-46d4-a7c3-41a5354d5337/fold_FE/MLLT6.txt" -sh "MLLT6.dat"

efn2 - Elapsed time since the previous call: 0.50 seconds
efn2 - Current memory usage: 176.39 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/c442bc83-8681-46d4-a7c3-41a5354d5337/ct/MLLT6.ct" 1 "/disk1/www/rails/humanrnamap/public/result/c442bc83-8681-46d4-a7c3-41a5354d5337/fold_dbn/MLLT6_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.01 seconds
ct2dot - Current memory usage: 176.39 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCUCACCAUCCACGCAGCAGGAGAAGCACCCCACCCACCACGAGAGGGGCCAGAAGAAGAGUCGAAAGGACA', '-structureDBN', '........(((........)))......((((.............))))...........(((.....))).', '-o', '/disk1/www/rails/humanrnamap/public/result/c442bc83-8681-46d4-a7c3-41a5354d5337/final_image/MLLT6_fold_1.svg', '-title', 'MLLT6, -12.7 ± 0.5\n kcal/mol, AUC: 0.768', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '64,3,68,69,9,14,17,20,21,23,26,42,44,46,47,48,49,53,56,59,61,62', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '32,1,2,4,6,7,11,15,29,30,31', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '70,39,8,10,12,13,18,50,55,63', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '65,66,67,5,71,72,16,19,22,24,25,27,28,33,34,35,36,37,38,40,41,43,45,51,52,54,57,58,60']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 22.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 39.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 57.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 109.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 149.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 144.75, Y: 129.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 133.0949319257163, Y: 115.980508719771, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 130.4117893094517, Y: 98.68741024798123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 137.56324539329538, Y: 82.71533508740521, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 152.24999272779968, Y: 73.19956072129798, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 169.75000727220032, Y: 73.19956072129798, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 184.43675460670462, Y: 82.71533508740524, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 191.5882106905483, Y: 98.68741024798123, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 188.9050680742837, Y: 115.980508719771, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 129.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 177.25, Y: 149.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 177.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 229.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 264.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 282.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 149.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 129.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 109.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 285.02773195655544, Y: 99.57396626348157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 275.0861604791117, Y: 85.17207898970898, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 271.4598078879651, Y: 68.05195143842423, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 274.7084165744473, Y: 50.856145493668805, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.3305504677494, Y: 36.23890430981527, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 298.84099374845556, Y: 26.456458997676577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 316.0, Y: 23.018770101480015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.15900625154444, Y: 26.456458997676577, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 347.6694495322506, Y: 36.23890430981527, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 357.2915834255527, Y: 50.85614549366875, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 360.5401921120349, Y: 68.05195143842423, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 356.9138395208883, Y: 85.17207898970901, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 346.97226804344456, Y: 99.57396626348157, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 109.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 129.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 149.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 332.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 349.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 367.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 402.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 419.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 437.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 454.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 472.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 489.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 507.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 524.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 542.25, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 542.25, Y: 149.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 542.25, Y: 129.03462290795116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 535.6018303951821, Y: 112.84658260829656, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 542.3280496512215, Y: 96.69081638204312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 558.5, Y: 90.00360248129869, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 574.6719503487785, Y: 96.69081638204312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 581.3981696048179, Y: 112.84658260829656, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 574.75, Y: 129.03462290795116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 574.75, Y: 149.03462290795116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 574.75, Y: 169.03462290795113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 592.25, Y: 169.03462290795116, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 189.03462290795113, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 121.0, Y: 149.03462290795113, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 193.01492453905948, Y: 133.41271841111393, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 276.0, Y: 149.03462290795113, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 337.11349333811177, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 346.0, Y: 189.03462290795113, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 521.0, Y: 189.03462290795113, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 591.0, Y: 149.03462290795116, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '72', X: 588.5, Y: 189.03462290795116, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'MLLT6, -12.7 ± 0.5
 kcal/mol, AUC: 0.768', X: 232.5, Y: 201.83462290795117, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 609.0, 201.83462290795117)
Updated viewBox: -0.25 -5.0 614.25 211.83462290795117
Updated SVG: /disk1/www/rails/humanrnamap/public/result/c442bc83-8681-46d4-a7c3-41a5354d5337/final_image/MLLT6_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/c442bc83-8681-46d4-a7c3-41a5354d5337/final_image/MLLT6_fold_final_1.svg
