Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 16% [=========                                         ] |                     
 22% [============                                      ] /                     
 28% [===============                                   ] -                     
 33% [=================                                 ] \                     
 39% [====================                              ] |                     
 44% [=======================                           ] /                     
 50% [==========================                        ] -                     
 56% [=============================                     ] \                     
 61% [===============================                   ] |                     
 67% [==================================                ] /                     
 73% [=====================================             ] -                     
 78% [========================================          ] \                     
 84% [===========================================       ] |                     
 89% [=============================================     ] /                     
 95% [================================================  ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/c66b7489-481b-404f-85c2-106f9ece9aee/final_image/BRCA1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.91 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.91 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.91 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.50 MB
Based on canonical annotations, the following gene is in your area of interest: BRCA1(-)
write fasta - Elapsed time since the previous call: 0.59 seconds
write fasta - Current memory usage: 172.50 MB
Length of region: 89 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.22 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/c66b7489-481b-404f-85c2-106f9ece9aee/fasta/BRCA1.fasta" "/disk1/www/rails/humanrnamap/public/result/c66b7489-481b-404f-85c2-106f9ece9aee/ct/BRCA1.ct" --SHAPE "BRCA1.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 176.22 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/c66b7489-481b-404f-85c2-106f9ece9aee/ct/BRCA1.ct" "/disk1/www/rails/humanrnamap/public/result/c66b7489-481b-404f-85c2-106f9ece9aee/fold_FE/BRCA1.txt" -sh "BRCA1.dat"

efn2 - Elapsed time since the previous call: 0.41 seconds
efn2 - Current memory usage: 176.22 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/c66b7489-481b-404f-85c2-106f9ece9aee/ct/BRCA1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/c66b7489-481b-404f-85c2-106f9ece9aee/fold_dbn/BRCA1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.22 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AACAUGUAAUGAUAGGCGGACUCCCAGCACAGAAAAAAAGGUAGAUCUGAAUGCUGAUCCCCUGUGUGAGAGAAAAGAAUGGAAUAAGC', '-structureDBN', '...........(((((.(((....(((((((((............))))..))))).))))))))........................', '-o', '/disk1/www/rails/humanrnamap/public/result/c66b7489-481b-404f-85c2-106f9ece9aee/final_image/BRCA1_fold_1.svg', '-title', 'BRCA1, -15.7 ± 0.7\n kcal/mol, AUC: 0.726', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '5,6,7,10,11,13,15,16,18,19,22,27,32,40,41,42,44,46,48,49,52,53,55,56,58,63,64,65,66,67,68,70,72,77,80,81,82,85,88', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '33,34,35,21,24,25,47', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '38,39,60,79,51,61,87,23,57,26,59,28,29,62', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '1,2,3,4,69,71,8,9,73,74,12,75,14,76,78,17,83,20,84,86,89,30,31,36,37,43,45,50,54']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 39.75, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 74.75, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 92.25, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 109.75, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 162.25, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 179.75, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 197.25, Y: 329.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 309.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 289.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 197.25, Y: 269.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 193.43438113341733, Y: 252.28056583378867, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 204.15572209255677, Y: 238.44925650078625, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 212.66734010780456, Y: 220.35084887020975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 221.17895812305235, Y: 202.25244123963336, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 216.28241325518215, Y: 185.45146031756747, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 221.36976485106817, Y: 168.7072683297012, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 234.7851243569789, Y: 157.46995366320476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 252.16190931221047, Y: 155.39716418852942, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.84412783853503, Y: 163.1635747931325, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 287.1545276095185, Y: 157.95699619631847, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 306.46492738050193, Y: 152.7504175995045, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 325.7753271514854, Y: 147.5438390026905, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 345.08572692246884, Y: 142.33726040587646, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 358.9648395146959, Y: 131.67822506585213, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 368.9774411974532, Y: 114.36499868997277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 378.99004288021047, Y: 97.05177231409334, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 389.00264456296776, Y: 79.73854593821386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 381.6097110277683, Y: 63.87684109427619, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 381.3599592485188, Y: 46.37864773436513, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 388.29718511810984, Y: 30.3124084716643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 401.2048927939305, Y: 18.495461769252756, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 417.81961658804624, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 435.2278370617622, Y: 14.789694597010907, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 450.376889038591, Y: 23.55070886565659, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 460.610269891151, Y: 37.74673165862691, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 464.1334776820667, Y: 54.888381336359316, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 460.3286908626568, Y: 71.96973795903182, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 449.86310802712035, Y: 85.99545443715158, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 434.57194951414294, Y: 94.50601365162589, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 417.1366374237718, Y: 96.00902367269452, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 407.1240357410145, Y: 113.32225004857395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 397.1114340582572, Y: 130.63547642445332, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 387.0988323754999, Y: 147.94870280033274, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 384.7820648692545, Y: 165.29467029488336, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 370.90283446118116, Y: 175.95379611643233, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 353.54641714229166, Y: 173.71666003372457, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 334.2360173713082, Y: 178.9232386305386, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 314.92561760032476, Y: 184.1298172273526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 295.6152178293413, Y: 189.33639582416657, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 276.3048180583578, Y: 194.5429744209806, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 266.65240112713485, Y: 209.1402634633282, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 250.58887052273917, Y: 216.083820514411, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 242.07725250749138, Y: 234.18222814498745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 233.56563449224356, Y: 252.28063577556395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 269.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 289.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 309.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 229.75, Y: 329.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 229.75, Y: 349.3595974952236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 247.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 264.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 282.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 299.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 334.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 352.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 404.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 422.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 439.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 457.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 474.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 492.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 509.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 527.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 544.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 562.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 579.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 597.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 614.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 632.25, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 649.75, Y: 349.3595974952237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 369.3595974952236, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 369.3595974952236, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 197.92262553403955, Y: 197.83622239011774, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 350.0081594021028, Y: 112.36785266641022, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 460.0425777992224, Y: 8.717661468784001, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 398.34527369950507, Y: 175.30730231649153, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 249.3344630859885, Y: 247.91997867737268, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 313.5, Y: 369.3595974952237, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 488.5, Y: 369.3595974952237, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '89', X: 646.0, Y: 369.3595974952237, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'BRCA1, -15.7 ± 0.7
 kcal/mol, AUC: 0.726', X: 261.25, Y: 382.1595974952237, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.7176614687840015, 664.0, 382.1595974952237)
Updated viewBox: -0.25 -4.2823385312159985 669.25 391.4419360264397
Updated SVG: /disk1/www/rails/humanrnamap/public/result/c66b7489-481b-404f-85c2-106f9ece9aee/final_image/BRCA1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/c66b7489-481b-404f-85c2-106f9ece9aee/final_image/BRCA1_fold_final_1.svg
