Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 18% [==========                                        ] |                     
 25% [=============                                     ] /                     
 31% [================                                  ] -                     
 37% [===================                               ] \                     
 44% [=======================                           ] |                     
 50% [==========================                        ] /                     
 56% [=============================                     ] -                     
 63% [================================                  ] \                     
 69% [===================================               ] |                     
 75% [======================================            ] /                     
 82% [==========================================        ] -                     
 88% [=============================================     ] \                     
 94% [================================================  ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/c88bf59c-55cb-49aa-a92c-1a8a26a9e200/final_image/SAMD4A_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.98 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.98 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.98 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.69 MB
Based on canonical annotations, the following gene is in your area of interest: SAMD4A(+)
write fasta - Elapsed time since the previous call: 0.44 seconds
write fasta - Current memory usage: 172.69 MB
Length of region: 79 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.25 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/c88bf59c-55cb-49aa-a92c-1a8a26a9e200/fasta/SAMD4A.fasta" "/disk1/www/rails/humanrnamap/public/result/c88bf59c-55cb-49aa-a92c-1a8a26a9e200/ct/SAMD4A.ct" --SHAPE "SAMD4A.dat"

fold - Elapsed time since the previous call: 0.09 seconds
fold - Current memory usage: 176.25 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/c88bf59c-55cb-49aa-a92c-1a8a26a9e200/ct/SAMD4A.ct" "/disk1/www/rails/humanrnamap/public/result/c88bf59c-55cb-49aa-a92c-1a8a26a9e200/fold_FE/SAMD4A.txt" -sh "SAMD4A.dat"

efn2 - Elapsed time since the previous call: 0.51 seconds
efn2 - Current memory usage: 176.25 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/c88bf59c-55cb-49aa-a92c-1a8a26a9e200/ct/SAMD4A.ct" 1 "/disk1/www/rails/humanrnamap/public/result/c88bf59c-55cb-49aa-a92c-1a8a26a9e200/fold_dbn/SAMD4A_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.25 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AAAGCUAAUGAACUACAUACAGACCUAAAAGGCCUUAAUGAAAUCCGAACAAUUUUCUUUUACUUUCAAGAUCAAAAAC', '-structureDBN', '....................((.(((...))).))....((((..........))))......................', '-o', '/disk1/www/rails/humanrnamap/public/result/c88bf59c-55cb-49aa-a92c-1a8a26a9e200/final_image/SAMD4A_fold_1.svg', '-title', 'SAMD4A, -3.6 ± 0.5\n kcal/mol, AUC: 0.835', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '64,65,66,4,6,70,72,9,10,14,18,22,26,31,32,35,36,39,40,44,47,53,54,55,56,58,59,60,61', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '1,34,3,7,41,73,76,23,24,25,27,28,57', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '2,68,8,74,11,12,75,77,15,78,17,21,30,33,42,43,45', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '67,5,69,71,13,79,16,19,20,29,37,38,46,48,49,50,51,52,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 39.75, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 57.25, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.25, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 144.75, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.25, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 179.75, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 197.25, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.75, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.25, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 249.75, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 267.25, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 284.75, Y: 142.41338478800395, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 302.25, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 319.75, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 337.25, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 354.75, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 354.75, Y: 122.41338478800397, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 348.07162284851074, Y: 106.23784835792121, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 354.75, Y: 90.06231192783846, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 354.75, Y: 70.06231192783844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 354.75, Y: 50.06231192783844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 355.69020113855714, Y: 32.58756404091699, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 371.0, Y: 24.11048608241191, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 386.30979886144286, Y: 32.58756404091699, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 387.25, Y: 50.06231192783844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 387.25, Y: 70.06231192783844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 387.25, Y: 90.06231192783844, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 393.92837715148926, Y: 106.2378483579212, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 387.25, Y: 122.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.25, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 404.75, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 422.25, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 439.75, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 457.25, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 474.75, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 474.75, Y: 122.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 474.75, Y: 102.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 474.75, Y: 82.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 461.4500727174621, Y: 71.03968499472128, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 455.01609813886415, Y: 54.76537751850378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 456.9430161580552, Y: 37.371812626399816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 466.7831056061255, Y: 22.900401072495015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 482.25001267560185, Y: 14.713588602876712, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 499.74998732439815, Y: 14.713588602876712, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 515.2168943938746, Y: 22.900401072495015, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 525.0569838419448, Y: 37.371812626399816, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 526.9839018611359, Y: 54.765377518503726, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 520.5499272825379, Y: 71.03968499472128, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 507.25, Y: 82.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 507.25, Y: 102.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 507.25, Y: 122.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 507.25, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 524.75, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 542.25, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 559.75, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 577.25, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 594.75, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 612.25, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 629.75, Y: 142.41338478800398, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 647.25, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 664.75, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 682.25, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 699.75, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 717.25, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 734.75, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 752.25, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 769.75, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 787.25, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 804.75, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 822.25, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 839.75, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 857.25, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 874.75, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 892.25, Y: 142.413384788004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 162.41338478800395, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 158.5, Y: 162.41338478800395, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 333.5, Y: 162.41338478800398, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 402.72267446459404, Y: 44.540646741660964, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 456.85786437626905, Y: 156.55552041173493, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 524.80773574211, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 556.0, Y: 162.41338478800398, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 731.0, Y: 162.413384788004, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '79', X: 888.5, Y: 162.413384788004, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'SAMD4A, -3.6 ± 0.5
 kcal/mol, AUC: 0.835', X: 382.5, Y: 175.21338478800402, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 0.0, 906.5, 175.21338478800402)
Updated viewBox: -0.25 -5.0 911.75 185.21338478800402
Updated SVG: /disk1/www/rails/humanrnamap/public/result/c88bf59c-55cb-49aa-a92c-1a8a26a9e200/final_image/SAMD4A_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/c88bf59c-55cb-49aa-a92c-1a8a26a9e200/final_image/SAMD4A_fold_final_1.svg
