Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 10% [======                                            ] \                     
 16% [=========                                         ] |                     
 21% [===========                                       ] /                     
 27% [==============                                    ] -                     
 32% [=================                                 ] \                     
 38% [====================                              ] |                     
 43% [======================                            ] /                     
 49% [=========================                         ] -                     
 54% [============================                      ] \                     
 60% [===============================                   ] |                     
 65% [=================================                 ] /                     
 71% [====================================              ] -                     
 76% [=======================================           ] \                     
 82% [==========================================        ] |                     
 87% [============================================      ] /                     
 93% [===============================================   ] -                     
 98% [==================================================] \                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/c9fb4369-ec28-413e-bf21-4d6cbc5dac7e/final_image/ADAR_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 159.12 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 159.12 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 159.12 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 172.79 MB
Based on canonical annotations, the following gene is in your area of interest: ADAR(-)
write fasta - Elapsed time since the previous call: 1.01 seconds
write fasta - Current memory usage: 172.79 MB
Length of region: 91 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.19 seconds
write dat - Current memory usage: 176.19 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/c9fb4369-ec28-413e-bf21-4d6cbc5dac7e/fasta/ADAR.fasta" "/disk1/www/rails/humanrnamap/public/result/c9fb4369-ec28-413e-bf21-4d6cbc5dac7e/ct/ADAR.ct" --SHAPE "ADAR.dat"

fold - Elapsed time since the previous call: 0.11 seconds
fold - Current memory usage: 176.19 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/c9fb4369-ec28-413e-bf21-4d6cbc5dac7e/ct/ADAR.ct" "/disk1/www/rails/humanrnamap/public/result/c9fb4369-ec28-413e-bf21-4d6cbc5dac7e/fold_FE/ADAR.txt" -sh "ADAR.dat"

efn2 - Elapsed time since the previous call: 0.52 seconds
efn2 - Current memory usage: 176.19 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/c9fb4369-ec28-413e-bf21-4d6cbc5dac7e/ct/ADAR.ct" 1 "/disk1/www/rails/humanrnamap/public/result/c9fb4369-ec28-413e-bf21-4d6cbc5dac7e/fold_dbn/ADAR_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 176.19 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CCUAGAGGGUAUAAAAUCAUCUCUGCUCAGAUAAUCAUGACUUAGCAAGAAUAAGGGCAAAAAAUCCUGUUGGCUUAACGUCACUGUUCCA', '-structureDBN', '..((((((...........))))))............(((((((((.......((((.......))))....)).))).))))........', '-o', '/disk1/www/rails/humanrnamap/public/result/c9fb4369-ec28-413e-bf21-4d6cbc5dac7e/final_image/ADAR_fold_1.svg', '-title', 'ADAR, -13.5 ± 0.9\n kcal/mol, AUC: 0.667', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,5,7,8,9,10,12,17,20,22,24,25,27,30,32,35,38,39,42,43,45,49,52,55,56,57,65,68,69,70,71,72,73,75,76,80,81,85,86,87,88', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '2,82,83,84,59,60,14', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,66,67,4,36,6,58,40,41,90,77,15,21,23,26', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,74,11,13,78,79,16,18,19,89,91,28,29,31,33,34,37,44,46,47,48,50,51,53,54,61,62,63']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 5.887313365673297, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 23.387313365673297, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 40.88731336567329, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 40.88731336567329, Y: 330.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 40.88731336567329, Y: 310.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 40.88731336567329, Y: 290.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 40.88731336567329, Y: 270.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 40.88731336567329, Y: 250.21670361854345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 27.012091703747615, Y: 239.55240067448975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 19.188944205613243, Y: 223.8984076799674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 18.98951968382727, Y: 206.39956876676425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 26.453881976242005, Y: 190.57135253695176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 40.08246123118738, Y: 179.5936040910365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.13731336567329, Y: 175.67172289434737, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 74.19216550015918, Y: 179.5936040910365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 87.82074475510461, Y: 190.57135253695176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 95.28510704751932, Y: 206.39956876676425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 95.08568252573335, Y: 223.8984076799674, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 87.26253502759894, Y: 239.55240067448975, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.3873133656733, Y: 250.21670361854345, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 73.3873133656733, Y: 270.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.3873133656733, Y: 290.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 73.3873133656733, Y: 310.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 73.3873133656733, Y: 330.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 73.3873133656733, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 90.8873133656733, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 108.3873133656733, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 125.8873133656733, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 143.3873133656733, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 160.8873133656733, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.3873133656733, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 195.8873133656733, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 213.3873133656733, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 230.8873133656733, Y: 350.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 248.3873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 265.8873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 283.3873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 300.8873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 300.8873133656733, Y: 330.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 300.8873133656733, Y: 310.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 300.8873133656733, Y: 290.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 297.0717101249954, Y: 273.13760201538764, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 288.5602182794262, Y: 255.03913504818823, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 280.048726433857, Y: 236.9406680809888, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 268.9958280100598, Y: 221.21020257198862, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 254.85369238632887, Y: 207.06806694825767, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 237.87595755467711, Y: 211.31124337646034, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 220.52310833473376, Y: 209.04703266085878, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 205.20256270359715, Y: 200.58955621814872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 194.03979046186734, Y: 187.11214763585807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 188.58343980145688, Y: 170.48457223577722, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 189.59048823670548, Y: 153.013628367062, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 196.92122461838932, Y: 137.12311766674176, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 209.5586317220198, Y: 125.01758306839196, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 205.12738481400186, Y: 105.5146589071237, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 200.6961379059839, Y: 86.01173474585539, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 196.26489099796595, Y: 66.5088105845872, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 182.96277854243385, Y: 55.13761906175796, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 178.9421841271315, Y: 38.10573681180904, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 185.75476078667103, Y: 21.986214744254312, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 200.7713561730638, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 218.1966715334296, Y: 14.615108980931723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 231.3058197826453, Y: 26.208228690853275, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 235.0396361403345, Y: 43.30526959960525, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 227.9571427600269, Y: 59.30803435905807, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 232.38838966804485, Y: 78.81095852032627, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 236.8196365760628, Y: 98.31388268159446, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 241.25088348408073, Y: 117.81680684286277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 257.8785424629318, Y: 123.27308367629365, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 271.35604220650674, Y: 134.43583426304141, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 279.8135926950884, Y: 149.75640343435785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 282.0778425062558, Y: 167.10930442504608, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 277.8346627748917, Y: 184.08709655969486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 291.97679839862263, Y: 198.2292321834258, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 306.2158609419745, Y: 206.80616673154336, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 309.45873525555606, Y: 223.10949383193886, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.97022710112526, Y: 241.2079607991383, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 326.48171894669446, Y: 259.3064277663377, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 337.2029478579169, Y: 273.13774189888375, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 333.3873133656733, Y: 290.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 333.3873133656733, Y: 310.2167036185434, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 333.3873133656733, Y: 330.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 333.3873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 350.8873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 368.3873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 385.8873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 403.3873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 420.8873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 438.3873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 455.8873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 473.3873133656733, Y: 350.2167036185435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 6.637313365673297, Y: 370.2167036185434, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: -4.0, Y: 228.60238984097262, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 88.46058596712143, Y: 256.97572785075124, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 157.1373133656733, Y: 370.2167036185434, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 277.1373133656733, Y: 310.2167036185434, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 172.78056855179142, Y: 196.77791962280855, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 166.91208375924302, Y: 8.863292045947105, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 283.00883671501106, Y: 121.67832975280163, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 349.5166565625058, Y: 288.0231416607793, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 452.1373133656733, Y: 370.2167036185435, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '91', X: 469.6373133656733, Y: 370.2167036185435, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'ADAR, -13.5 ± 0.9
 kcal/mol, AUC: 0.667', X: 173.6373133656733, Y: 383.0167036185435, Width: 142.5, Height: 23
Calculated bounding box: (-4.0, 0.8632920459471052, 487.6373133656733, 383.0167036185435)
Updated viewBox: -9.0 -4.136707954052895 501.6373133656733 392.1534115725964
Updated SVG: /disk1/www/rails/humanrnamap/public/result/c9fb4369-ec28-413e-bf21-4d6cbc5dac7e/final_image/ADAR_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/c9fb4369-ec28-413e-bf21-4d6cbc5dac7e/final_image/ADAR_fold_final_1.svg
