Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  5% [===                                               ] -                     
 11% [======                                            ] \                     
 16% [=========                                         ] |                     
 22% [============                                      ] /                     
 27% [==============                                    ] -                     
 33% [=================                                 ] \                     
 38% [====================                              ] |                     
 44% [=======================                           ] /                     
 50% [==========================                        ] -                     
 55% [============================                      ] \                     
 61% [===============================                   ] |                     
 66% [==================================                ] /                     
 72% [=====================================             ] -                     
 77% [=======================================           ] \                     
 83% [==========================================        ] |                     
 88% [=============================================     ] /                     
 94% [================================================  ] -                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/cca74250-5e82-41f9-97cd-3770358f4d69/final_image/CLASP1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 157.09 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 157.09 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 157.09 MB
read annotations - Elapsed time since the previous call: 0.09 seconds
read annotations - Current memory usage: 170.69 MB
Based on canonical annotations, the following gene is in your area of interest: CLASP1(-)
write fasta - Elapsed time since the previous call: 1.50 seconds
write fasta - Current memory usage: 170.69 MB
Length of region: 90 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.18 seconds
write dat - Current memory usage: 173.74 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/cca74250-5e82-41f9-97cd-3770358f4d69/fasta/CLASP1.fasta" "/disk1/www/rails/humanrnamap/public/result/cca74250-5e82-41f9-97cd-3770358f4d69/ct/CLASP1.ct" --SHAPE "CLASP1.dat"

fold - Elapsed time since the previous call: 0.10 seconds
fold - Current memory usage: 173.74 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/cca74250-5e82-41f9-97cd-3770358f4d69/ct/CLASP1.ct" "/disk1/www/rails/humanrnamap/public/result/cca74250-5e82-41f9-97cd-3770358f4d69/fold_FE/CLASP1.txt" -sh "CLASP1.dat"

efn2 - Elapsed time since the previous call: 0.40 seconds
efn2 - Current memory usage: 173.74 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/cca74250-5e82-41f9-97cd-3770358f4d69/ct/CLASP1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/cca74250-5e82-41f9-97cd-3770358f4d69/fold_dbn/CLASP1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 173.74 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'AUUAGCUGAAACAAUAAAGAAGGGAAUACAUGAUGCUGAUUCCGAAGCAAGAAUAGAAGCCAGAAAAUGUUACUGGGGUUUCCACAGUCA', '-structureDBN', '....((((..............(((((.((......)))))))............((((((...............))))))..))))..', '-o', '/disk1/www/rails/humanrnamap/public/result/cca74250-5e82-41f9-97cd-3770358f4d69/final_image/CLASP1_fold_1.svg', '-title', 'CLASP1, -10.1 ± 0.6\n kcal/mol, AUC: 0.743', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '2,3,5,7,8,15,19,22,23,24,27,31,32,34,35,37,38,40,41,44,47,51,54,56,59,63,68,69,70,71,74,75,76,77,78,79,80,81,87,88', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '26,4,25,58,43,62,57', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '65,66,67,6,72,73,16,82,20,84,86,90,30,33,42,53,55,60,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '64,1,9,10,11,12,13,14,17,18,83,21,85,89,28,29,36,39,45,46,48,49,50,52']
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 20.526099494534378, Y: 439.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 38.02609949453438, Y: 439.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 55.52609949453438, Y: 439.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 73.02609949453438, Y: 439.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 90.52609949453438, Y: 439.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 90.52609949453438, Y: 419.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 90.52609949453438, Y: 399.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 90.52609949453438, Y: 379.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 73.23283672005215, Y: 375.06036787434664, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 56.96465872367662, Y: 367.746573690162, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 42.21872231879601, Y: 357.71150716155387, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 29.445664494697922, Y: 345.26184071973216, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 19.035830914336685, Y: 330.7780371612896, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 11.307346919829257, Y: 314.7027226748786, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 6.49639559669933, Y: 297.5271601496846, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 4.75, Y: 279.7762361424618, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 6.1215301180583594, Y: 261.9924203026137, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 10.569071881387941, Y: 244.719187456565, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 17.95670805998526, Y: 228.48440897384307, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 28.058671904688737, Y: 213.78422097604266, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 40.566246596988236, Y: 201.06786237749247, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 55.09719965955114, Y: 190.72394610830474, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 71.20746401112902, Y: 183.0685830723246, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 67.30985556614368, Y: 163.45204289803348, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 63.41224712115833, Y: 143.83550272374225, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 59.51463867617299, Y: 124.21896254945113, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 55.61703023118764, Y: 104.6024223751599, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 48.54619929009348, Y: 88.59443625479526, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 56.36652866937938, Y: 72.93893504190532, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 61.18792818550973, Y: 53.52878031027433, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 56.24187241423924, Y: 36.742307061656675, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 63.2773447274771, Y: 20.7188467253643, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 78.98303022825691, Y: 13.0, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 95.96689209938484, Y: 17.218718734582694, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 106.2353071243972, Y: 31.38942107050002, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 104.95534382027472, Y: 48.842525257411125, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 92.72942962441013, Y: 61.36355452398618, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 87.90803010827977, Y: 80.77370925561718, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 87.49390801441078, Y: 98.26880865205874, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 91.39151645939612, Y: 117.88534882634985, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 95.28912490438147, Y: 137.50188900064109, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 99.1867333493668, Y: 157.11842917493232, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 103.08434179435217, Y: 176.73496934922343, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 120.56275665560383, Y: 177.60388472944055, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 137.6356030535186, Y: 181.4467893435584, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 153.80064117771363, Y: 188.15063469106747, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 168.58233663321445, Y: 197.5182106561091, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 181.54584945545514, Y: 209.27394692856785, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 192.30982599841843, Y: 223.07201958320104, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 200.55761739103127, Y: 238.5065243418236, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 206.04659454330147, Y: 255.12341724699263, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.61528567835597, Y: 272.4338714828783, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 208.1881264223034, Y: 289.92865741954995, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 204.77768271633272, Y: 307.0931228562714, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 198.48428115861537, Y: 323.4223327830658, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 189.49305765041487, Y: 338.43592328719194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 203.63519327414582, Y: 352.5780589109229, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 217.77732889787677, Y: 366.72019453465384, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 231.91946452160772, Y: 380.8623301583848, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 246.06160014533867, Y: 395.00446578211574, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 260.2037357690696, Y: 409.1466014058467, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 277.0264683385227, Y: 404.3251626925213, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 294.48082396814783, Y: 405.5885200941542, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 310.4338879322255, Y: 412.7822918814529, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 322.9362026987014, Y: 425.0274022463965, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 330.45999079833797, Y: 440.82750398662137, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 332.0858485721614, Y: 458.2518314878188, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 327.6150969018302, Y: 475.1711394486049, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 317.5940597121588, Y: 489.51789573749863, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 303.24730342326507, Y: 499.53893292717, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 286.327995462479, Y: 504.0096845975013, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 268.90366796128154, Y: 502.3838268236778, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 253.10356622105672, Y: 494.8600387240412, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 240.8584558561131, Y: 482.3577239575653, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 233.66468406881444, Y: 466.4046599934877, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 232.40132666718148, Y: 448.95030436386253, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 237.22276538050681, Y: 432.1275717944095, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 223.08062975677586, Y: 417.98543617067855, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 208.9384941330449, Y: 403.8433005469476, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 194.79635850931396, Y: 389.70116492321665, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 180.654222885583, Y: 375.5590292994857, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 166.51208726185206, Y: 361.41689367575475, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 153.01069827626037, Y: 369.65511831113486, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 138.39832770629903, Y: 375.70776037963435, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 123.02609949453438, Y: 379.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 123.02609949453438, Y: 399.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 123.02609949453438, Y: 419.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 123.02609949453438, Y: 439.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 140.52609949453438, Y: 439.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 158.02609949453438, Y: 439.42937958216817, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 21.276099494534378, Y: 459.42937958216817, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 43.450751338235946, Y: 385.2012610998103, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 8.878689139423095, Y: 201.05961363971971, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 39.72798498710662, Y: 44.23588453396576, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 107.25805663368726, Y: 113.98774038136446, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 215.19042344997905, Y: 230.6279177772646, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 256.4537357690696, Y: 380.8623301583848, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 307.9077835789225, Y: 517.6845611486258, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '80', X: 176.904222885583, Y: 403.8433005469476, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '90', X: 154.27609949453438, Y: 459.42937958216817, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'CLASP1, -10.1 ± 0.6
 kcal/mol, AUC: 0.743', X: 102.4179242860807, Y: 530.4845611486257, Width: 142.5, Height: 23
Calculated bounding box: (4.75, 5.0, 342.5858485721614, 530.4845611486257)
Updated viewBox: -0.25 0.0 347.8358485721614 535.4845611486257
Updated SVG: /disk1/www/rails/humanrnamap/public/result/cca74250-5e82-41f9-97cd-3770358f4d69/final_image/CLASP1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/cca74250-5e82-41f9-97cd-3770358f4d69/final_image/CLASP1_fold_final_1.svg
