Initializing nucleic acids...done.
Applying constraints...done.
Folding single strand...
  0% [=                                                 ] /                     
  6% [====                                              ] -                     
 12% [=======                                           ] \                     
 19% [==========                                        ] |                     
 25% [=============                                     ] /                     
 32% [=================                                 ] -                     
 38% [====================                              ] \                     
 44% [=======================                           ] |                     
 51% [==========================                        ] /                     
 57% [=============================                     ] -                     
 64% [=================================                 ] \                     
 70% [====================================              ] |                     
 76% [=======================================           ] /                     
 83% [==========================================        ] -                     
 89% [=============================================     ] \                     
 96% [================================================= ] |                     done.
Writing output ct file...done.
Single strand folding complete.
Initializing nucleic acids...done.
Applying SHAPE constraints...done.
Calculating free energies...done.
efn2 complete.
Converting CT file...CT file conversion complete.
/disk1/www/rails/humanrnamap/cli/./main.py:567: DeprecationWarning: Call to deprecated function (or staticmethod) VARNA. (Class has been renamed 'Structure')
  v = VARNA(structure=fold_dbn, sequence=seq)
Output file: /disk1/www/rails/humanrnamap/public/result/cd42fd69-0864-480d-924e-bbb2e09165ae/final_image/HCFC1_fold_1.svg

first - Elapsed time since the previous call: 0.00 seconds
first - Current memory usage: 158.75 MB
setup complete - Elapsed time since the previous call: 0.00 seconds
setup complete - Current memory usage: 158.75 MB
config complete - Elapsed time since the previous call: 0.00 seconds
config complete - Current memory usage: 158.75 MB
read annotations - Elapsed time since the previous call: 0.10 seconds
read annotations - Current memory usage: 172.37 MB
Based on canonical annotations, the following gene is in your area of interest: HCFC1(-)
write fasta - Elapsed time since the previous call: 0.53 seconds
write fasta - Current memory usage: 172.37 MB
Length of region: 78 nt.
100.0% of the region's A/C bases included in the filtered DMS dataset. Ideally, this number should be as high as possible for an experimenally-accurate prediction, and over 70% is recommended.
write dat - Elapsed time since the previous call: 0.22 seconds
write dat - Current memory usage: 175.95 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/Fold "/disk1/www/rails/humanrnamap/public/result/cd42fd69-0864-480d-924e-bbb2e09165ae/fasta/HCFC1.fasta" "/disk1/www/rails/humanrnamap/public/result/cd42fd69-0864-480d-924e-bbb2e09165ae/ct/HCFC1.ct" --SHAPE "HCFC1.dat"

fold - Elapsed time since the previous call: 0.08 seconds
fold - Current memory usage: 175.95 MB
Running command: /disk1/www/rails/humanrnamap/cli/bin/efn2 "/disk1/www/rails/humanrnamap/public/result/cd42fd69-0864-480d-924e-bbb2e09165ae/ct/HCFC1.ct" "/disk1/www/rails/humanrnamap/public/result/cd42fd69-0864-480d-924e-bbb2e09165ae/fold_FE/HCFC1.txt" -sh "HCFC1.dat"

efn2 - Elapsed time since the previous call: 0.51 seconds
efn2 - Current memory usage: 175.95 MB
This region has 1 predicted structures. 5 is the maximum structures visible on the web server. For up to 20 predictions per region, download and run the code locally.
Running command: /disk1/www/rails/humanrnamap/cli/bin/ct2dot "/disk1/www/rails/humanrnamap/public/result/cd42fd69-0864-480d-924e-bbb2e09165ae/ct/HCFC1.ct" 1 "/disk1/www/rails/humanrnamap/public/result/cd42fd69-0864-480d-924e-bbb2e09165ae/fold_dbn/HCFC1_temp1.dbn"

ct2dot - Elapsed time since the previous call: 0.02 seconds
ct2dot - Current memory usage: 175.95 MB
['java', '-cp', '/disk1/www/rails/humanrnamap/cli/bin/VARNAv3-93.jar', 'fr.orsay.lri.varna.applications.VARNAcmd', '-sequenceDBN', 'CAGACCAAAGGGCCCCUGCCAGCGGGAACAAUCCUGAAGCUGGUGACCUCAGCAGAUGGCAAGCCCACCACCAUCAUC', '-structureDBN', '.........((((...(((((.(((((....)))))..(((((.....)))))...))))).))))............', '-o', '/disk1/www/rails/humanrnamap/public/result/cd42fd69-0864-480d-924e-bbb2e09165ae/final_image/HCFC1_fold_1.svg', '-title', 'HCFC1, -28.8 ± 0.7\n kcal/mol, AUC: 0.82', '-titleSize', '12', '-basesStyle1', 'fill=#ffffff', '-applyBasesStyle1on', '3,10,11,12,74,77,17,18,22,24,25,26,32,35,36,39,41,42,43,44,45,49,52,55,57,58,59,63', '-basesStyle2', 'fill=#00ffff', '-applyBasesStyle2on', '64,65,2,66,69,72,75,13,14,15,19,20,21,33,34,40', '-basesStyle3', 'fill=#ffff00', '-applyBasesStyle3on', '1,4,70,7,71,9,73,78,16,50,53,23,61', '-basesStyle4', 'fill=#ff0000', '-applyBasesStyle4on', '67,68,5,6,8,76,27,28,29,30,31,37,38,46,47,48,51,54,56,60,62']
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 4.75, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 22.25, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 39.75, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 57.25, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 74.75, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 92.25, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 109.75, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 127.25, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 144.75, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.25, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.25, Y: 314.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 162.25, Y: 294.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25, Y: 274.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 151.87031610366017, Y: 260.1294740949338, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 151.87031784047466, Y: 242.62946880912753, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 162.25000453347002, Y: 228.5400298863561, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 178.96359459307448, Y: 223.35292160497798, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 190.8260916858514, Y: 207.25071173416026, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 202.68858877862831, Y: 191.1485018633426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 214.55108587140523, Y: 175.04629199252489, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 226.41358296418215, Y: 158.94408212170717, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 220.86533532046593, Y: 141.18950863645838, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 223.6895490590848, Y: 122.80386890547001, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 209.54741343535386, Y: 108.66173328173903, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 195.4052778116229, Y: 94.51959765800814, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 181.26314218789196, Y: 80.37746203427719, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 167.121006564161, Y: 66.23532641054624, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 152.49437618443258, Y: 56.627364330511114, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 150.71072023151208, Y: 39.21846364614282, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 163.08511418832038, Y: 26.844069689334447, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 180.4940148726887, Y: 28.627725642254973, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 190.10197695272382, Y: 43.254356021983426, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 204.24411257645477, Y: 57.39649164571438, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 218.38624820018572, Y: 71.53862726944533, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 232.52838382391667, Y: 85.68076289317628, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 246.67051944764762, Y: 99.82289851690723, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 263.17781105450797, Y: 96.90015310383717, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 279.48337439734433, Y: 100.7939585710244, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 292.8889242399075, Y: 110.85995829097777, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 311.89507635575006, Y: 104.63370887825323, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 330.9012284715926, Y: 98.40745946552863, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 349.90738058743517, Y: 92.18121005280409, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 368.9135327032777, Y: 85.95496064007955, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 382.22749241802444, Y: 74.59761567958083, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 399.67439587487127, Y: 75.96010149790425, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 411.0638359243922, Y: 89.24661583372745, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 409.7434555110405, Y: 106.69675633177798, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 396.4844639234709, Y: 118.118225147934, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 379.03118799895515, Y: 116.83995782832378, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 360.0250358831126, Y: 123.06620724104832, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 341.01888376727004, Y: 129.29245665377286, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 322.0127316514275, Y: 135.5187060664974, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 303.0065795355849, Y: 141.74495547922194, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 297.7896636857755, Y: 158.44925998482788, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 286.1113249842953, Y: 171.48254066060215, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 270.07753116598866, Y: 178.49449158684465, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 252.57967400426094, Y: 178.22063989746968, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 240.717176911484, Y: 194.3228497682874, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 228.85467981870707, Y: 210.42505963910511, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 216.99218272593015, Y: 226.52726950992277, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 205.12968563315323, Y: 242.6294793807405, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 205.12968215952534, Y: 260.1294793807401, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'G', X: 194.75, Y: 274.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 294.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 314.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 194.75, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 212.25, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 229.75, Y: 334.21891507800035, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 247.25, Y: 334.2189150780004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 264.75, Y: 334.2189150780004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 282.25, Y: 334.2189150780004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 299.75, Y: 334.2189150780004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 317.25, Y: 334.2189150780004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 334.75, Y: 334.2189150780004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 352.25, Y: 334.2189150780004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'A', X: 369.75, Y: 334.2189150780004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'U', X: 387.25, Y: 334.2189150780004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'C', X: 404.75, Y: 334.2189150780004, Width: 10.5, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '1', X: 5.5, Y: 354.21891507800035, Width: 9.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '10', X: 144.35786437626905, Y: 348.3610507017313, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '20', X: 194.69887600058755, Y: 163.18379489974797, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '30', X: 152.63429054167023, Y: 8.0, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '40', X: 301.9188269430255, Y: 85.62755676241062, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '50', X: 362.5012852958372, Y: 142.07235935689087, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '60', X: 229.34439259674784, Y: 238.3897666026997, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '70', X: 261.0, Y: 354.2189150780004, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: '78', X: 401.0, Y: 354.2189150780004, Width: 18.0, Height: 8
Warning: Font Verdana not found. Using default font.
Text: 'HCFC1, -28.8 ± 0.7
 kcal/mol, AUC: 0.82', X: 146.4069179621961, Y: 367.0189150780004, Width: 133.5, Height: 23
Calculated bounding box: (4.75, 0.0, 421.5638359243922, 367.0189150780004)
Updated viewBox: -0.25 -5.0 426.8138359243922 377.0189150780004
Updated SVG: /disk1/www/rails/humanrnamap/public/result/cd42fd69-0864-480d-924e-bbb2e09165ae/final_image/HCFC1_fold_final_1.svg
Combined SVG saved as /disk1/www/rails/humanrnamap/public/result/cd42fd69-0864-480d-924e-bbb2e09165ae/final_image/HCFC1_fold_final_1.svg
